Biologia - Matura Maj 2015, Poziom rozszerzony (Formuła 2015) - Zadanie 19.

Kategoria: Skład organizmów Genetyka - pozostałe Typ: Podaj i uzasadnij/wyjaśnij

Cząsteczka insuliny składa się z dwóch różnych łańcuchów polipeptydowych – A i B. Występują w niej trzy mostki dwusiarczkowe stabilizujące strukturę cząsteczki: jeden w łańcuchu polipeptydowym A oraz dwa – łączące łańcuchy A i B. Początek sekwencji kodującej (znajdującej się na nici nieulegającej transkrypcji) genu kodującego jeden z łańcuchów polipeptydowych insuliny jest następujący:

5’ ATGGCCCTGTGGATGCGCCTCCTGCCCCTGCTGGCG ... 3’.

Podczas eksperymentu użyto czynnika mutagennego, który w dwu przypadkach wywołał delecje, tzn. transkrybowane mRNA było pozbawione fragmentu sekwencji składającego się z kolejnych nukleotydów. W wyniku translacji powstały łańcuchy polipeptydowe (1. i 2.) o innej sekwencji aminokwasów niż w łańcuchu prawidłowym.

I. przypadek – polipeptyd 1. powstał na podstawie delecji 4 nukleotydów (od 10 do 13 nukleotydu sekwencji kodującej włącznie)
II. przypadek – polipeptyd 2. powstał na podstawie delecji 9 nukleotydów (od 10 do 18 nukleotydu sekwencji kodującej włącznie).

19.1. (0–1)

Na podstawie tekstu uzasadnij, że cząsteczka insuliny ma strukturę III- i IV-rzędową.

Struktura III-rzędowa:

Struktura IV-rzędowa:
 

19.2. (0–1)

Określ, który polipeptyd (1. czy 2.) będzie miał bardziej zmienioną sekwencję aminokwasów w porównaniu z polipeptydem prawidłowym. Odpowiedź uzasadnij.
 

19.3. (0–1)

Podaj nazwę czwartego aminokwasu w sekwencji prawidłowego polipeptydu oraz nazwę czwartego aminokwasu w polipeptydzie 1. Przyjmij założenie, że w ich skład nie wchodzi aminokwas kodowany przez kodon START.

Polipeptyd prawidłowy:
Polipeptyd 1:
 

19.4. (0–1)

Określ, czy opisane mutacje mogły być spowodowane działaniem kolchicyny, która jest czynnikiem mutagennym blokującym wrzeciono kariokinetyczne. Odpowiedź uzasadnij.

Rozwiązanie

19.1. (0–1)

Przykładowe rozwiązania

Cząsteczka insuliny ma strukturę:

  • III-rzędową, ponieważ występuje mostek siarczkowy stabilizujący strukturę przestrzenną łańcucha polipeptydowego A.
  • III-rzędową, ponieważ cząsteczka ma strukturę IV-rzędową.
  • IV-rzędową, ponieważ składa się z dwóch (różnych) łańcuchów polipeptydowych/ z łańcucha polipeptydowego A i B/ponieważ występują mostki siarczkowe między łańcuchami A i B.

Schemat punktowania
1 p. – za poprawne uzasadnienie, że cząsteczka insuliny ma strukturę III- i IV-rzędową.
0 p. – za odpowiedź, która nie spełnia powyższych wymagań, lub za brak odpowiedzi.
 

19.2. (0–1)

Rozwiązanie

Polipeptyd 1., ponieważ:

  • w tym przypadku w wyniku mutacji ulegają delecji 4 nukleotydy, a więc dojdzie do przesunięcia ramki odczytu i od miejsca mutacji do końca mRNA będą odczytywane inne kodony, natomiast w przypadku polipeptydu 2. delecja 3 kodonów spowoduje, że w polipeptydzie 2. będzie mniej o 3 aminokwasy, ale sekwencja dalszych aminokwasów (od miejsca delecji) nie zmieni się.
  • od miejsca mutacji będzie zawierał zupełnie inne aminokwasy, natomiast z polipeptydu 2. wypadną tylko trzy aminokwasy i sekwencja dalszych aminokwasów (od miejsca delecji) nie zmieni się.

Schemat punktowania
1 p. – za wskazanie polipeptydu 1. i uzasadnienie uwzględniające prawidłowe porównanie polipeptydu 1. i 2. z polipeptydem prawidłowym (niezmutowanym)
0 p. – za odpowiedź, która nie spełnia powyższych wymagań, lub za brak odpowiedzi.
 

19.3. (0–1)

Rozwiązanie

polipeptyd prawidłowy: metionina
polipeptyd 1.: alanina

Schemat punktowania
1 p. – za poprawne podanie obydwu nazw aminokwasów.
0 p. – za każde inne rozwiązanie lub za brak odpowiedzi.

Uwaga: Nie uznaje się odpowiedzi „polipeptyd prawidłowy: arginina” − od kodonu START rozpoczynana jest translacja, a kodony AUG występujące po nim nie są już więcej tak nazywane.
 

19.4. (0–1)

Przykładowe rozwiązania

Opisane mutacje nie mogły być spowodowane działaniem kolchicyny, ponieważ:

  • kolchicyna powoduje mutacje chromosomowe/chromosomowe liczbowe/genomowe (a nie genowe).
  • opisane mutacje nie polegają na zaburzeniach liczby chromosomów.

Schemat punktowania
1 p. – za właściwe określenie, że opisane mutacje nie mogły być wywołane za pomocą kolchicyny i prawidłowe uzasadnienie odwołujące się do działania kolchicyny.
0 p. – za odpowiedź, która nie spełnia powyższych wymagań, lub za brak odpowiedzi.