Zadania maturalne z biologii

Znalezionych zadań - 53

Strony

1

Biomedica 2022, Poziom rozszerzony (Formuła 2015)Zadanie 26. (3 pkt)

Skład organizmów Ekspresja informacji genetycznej Podaj i uzasadnij/wyjaśnij Podaj/wymień

Poniżej przedstawiono schemat budowy polirybosomu.

26.1. (0–1)

Podaj, z jakiego rodzaju RNA zbudowane są rybosomy.

26.2. (0–1)

Wyjaśnij, jakie znaczenie dla efektywności pracy komórki ma występowanie polirybosomów.

26.3. (0–1)

Podaj, jak nazywa się proces zachodzący na polirybosomie.

To zadanie pochodzi ze zbioru matura 2022 wydawnictwa Biomedica
Kup pełny zbiór zadań
2

Matura Maj 2021, Poziom rozszerzony (Formuła 2015)Zadanie 1. (3 pkt)

Skład organizmów Ekspresja informacji genetycznej Podaj i uzasadnij/wyjaśnij Podaj/wymień

Prolaktyna, wydzielana przez gruczołową część przysadki mózgowej, jest jednołańcuchowym polipeptydem złożonym ze 199 aminokwasów, powstającym w wyniku odcięcia peptydu sygnałowego liczącego 28 aminokwasów. Na poniższym schemacie przedstawiono strukturę przestrzenną cząsteczki dojrzałej ludzkiej prolaktyny.

Na podstawie: S.J. Konturek, Fizjologia człowieka, Wrocław 2013; Protein Data Bank, https://www.rcsb.org/structure/1RW5.

1.1. (0–1)

Określ dominującą strukturę II-rzędową w cząsteczce dojrzałej ludzkiej prolaktyny.

1.2. (0–1)

Na podstawie przedstawionych informacji określ najwyższą rzędowość struktury białka – prolaktyny. Odpowiedź uzasadnij, odwołując się do cech budowy tego białka.

1.3. (0–1)

Podaj całkowitą liczbę kodonów w mRNA stanowiącym matrycę podczas syntezy prolaktyny.

3

Matura Marzec 2021, Poziom rozszerzony (Formuła 2015)Zadanie 2. (5 pkt)

Budowa i funkcje komórki Ekspresja informacji genetycznej Podaj/wymień Zamknięte (np. testowe, prawda/fałsz)

Na poniższym rysunku przedstawiono jeden z etapów translacji. Literami: E, P i A zaznaczono trzy miejsca funkcyjne rybosomu.

https://pl.khanacademy.org

2.1. (0–1)

Podaj nazwę aminokwasu oznaczonego na rysunku literą X.

Nazwa aminokwasu:

2.2. (0–1)

Oceń czy poniższe stwierdzenia dotyczące rybosomów w komórkach eukariotycznych są prawdziwe. Zaznacz P, jeśli stwierdzenie jest prawdziwe, albo F – jeśli jest fałszywe.

1. Funkcjonalny rybosom w komórce eukariotycznej składa się z dwóch podjednostek: małej i dużej, które są zbudowane z białek i rRNA. P F
2. Wszystkie rybosomy w komórce eukariotycznej są jednakowej wielkości i pełnią te same funkcje. P F
3. W komórkach eukariotycznych białka produkowane na eksport powstają na rybosomach związanych z siateczką śródplazmatyczną. P F

2.3. (0–2)

Do funkcji rybosomu 1.–4., pełnionych podczas translacji przez poszczególne miejsca funkcyjne rybosomu, przyporządkuj ze schematu ich odpowiednie oznaczenia wybrane spośród: E, P lub A.

  1. Przyłączanie inicjatorowego tRNA rozpoczynającego translację:
  2. Wiązanie aminoacylo-tRNA:
  3. Wiązanie peptydylo-tRNA:
  4. Uwalnianie z rybosomu wolnego tRNA:

2.4. (0–1)

Uzupełnij poniższe zdania tak, aby zawierały one prawdziwe informacje dotyczące translacji. Podkreśl w każdym nawiasie właściwe określenie.

Do połączenia podjednostek rybosomu dochodzi tylko w przypadku przyłączenia do (małej / dużej) podjednostki odpowiedniego rodzaju kwasu nukleinowego – (tRNA / końca 3ʹ mRNA / końca 5ʹ mRNA). Zachodzi wtedy proces (inicjacji / elongacji / terminacji) translacji.

4

Informator CKE, Poziom rozszerzony (Formuła 2023)Zadanie 12. (2 pkt)

Ekspresja informacji genetycznej Zamknięte (np. testowe, prawda/fałsz)

Uzupełnij poniższe zdania tak, aby powstał poprawny opis zjawiska alternatywnego składania eksonów. W każdym nawiasie podkreśl właściwe określenie.

W wyniku alternatywnego składania eksonów może powstać (tylko jeden rodzaj / wiele rodzajów) mRNA. Dzięki temu w organizmach eukariotycznych obserwuje się znacznie (mniej / więcej) różnych białek w porównaniu z liczbą genów w genomie. Ze względu na to, że ten proces nie zachodzi w organizmach prokariotycznych, gdy planuje się otrzymanie eukariotycznego białka w komórkach bakterii, należy przeprowadzić odwrotną (transkrypcję / translację) mRNA, która pozwala uzyskać gen pozbawiony (eksonów / intronów).

5

Informator CKE, Poziom rozszerzony (Formuła 2023)Zadanie 14. (8 pkt)

Metody badawcze i doświadczenia Ekspresja informacji genetycznej Choroby człowieka Układ immunologiczny Uzupełnij/narysuj wykres, schemat lub tabelę Zamknięte (np. testowe, prawda/fałsz) Podaj i uzasadnij/wyjaśnij

Współcześnie stosuje się dwie podstawowe metody wykrywania zakażeń HIV. Rutynowe badanie polega na wykrywaniu przeciwciał anty-HIV w surowicy pacjenta. W przypadku tej metody czułość badania, czyli prawdopodobieństwo otrzymania wyniku dodatniego u osoby chorej, tzn. wykrycia zakażenia, wynosi 100%, ale wynik dodatni otrzymuje się także dla 0,5% zdrowych osób – specyficzność wynosi 99,5%. Dlatego postawienie diagnozy zakażenia HIV wymaga potwierdzenia dodatkowym badaniem za pomocą metody PCR, wykrywającym gen odwrotnej transkryptazy wbudowany w genom gospodarza. Ta metoda jest teoretycznie bezbłędna pod warunkiem utrzymywania wysokich standardów pracy laboratoryjnej. Odpowiednie próby kontrolne służą sprawdzeniu, czy:

  • polimeraza DNA nie utraciła aktywności podczas przechowywania (kontrola pozytywna),
  • wszystkie odczynniki są wolne od wirusowego materiału genetycznego (kontrola negatywna).

Dla trzech pacjentów uzyskano dodatni wynik testu na obecność przeciwciał anty-HIV. Z tego powodu lekarz zlecił dodatkowe badanie z wykorzystaniem metody PCR, którego wyniki podsumowano w poniższej tabeli.

Próba
badawcza kontrolna pozytywna kontrolna negatywna
Pacjent 1. +
Pacjent 2. + + +
Pacjent 3. + +

Na podstawie: GenBank sekwencja nr KR861191.1; M. Fearon, The Laboratory Diagnosis of HIV Infections, „Can J Dis Med Microbiol” 16, 2005, s. 26–30;
D.S Boyle i inni, Rapid Detection of HIV-1 Proviral DNA for Early Infant Diagnosis Using Recombinase Polymerase Amplification, „mBio” 4, 2013, e00135–13;
S. Koblavi-Dème i inni, Sensitivity and Specificity of Human Immunodeficiency Virus Rapid Serologic Assays and Testing Algorithms in an Antenatal Clinic in Abidjan, Ivory Coast, „J Clin Microbiol” 39, 2001, s. 1808–1812.

14.1. (0–2)

Zaprojektuj doświadczenie PCR wykrywające DNA HIV wbudowane w genom gospodarza. Dla każdej z prób – badawczej, kontrolnej pozytywnej i kontrolnej negatywnej – wybierz wszystkie właściwe składniki mieszaniny reakcyjnej. Wpisz w tabelę znak „+”, jeśli składnik należy dodać do próby, albo znak „–”, jeśli ten składnik należy pominąć.

Próba
badawcza kontrolna pozytywna kontrolna negatywna
DNA genomowy wyizolowany od pacjenta
DNA genomowy wyizolowany z linii komórkowej zakażonej HIV
para specyficznych starterów
bufor zapewniający optymalne pH i stężenie jonów Mg2+
termostabilna polimeraza DNA
mieszanina deoksyrybonukleotydów

14.2. (0–1)

Wybierz spośród A–D i zaznacz prawidłowe sekwencje starterów polF1 i polR1, wykorzystywanych w teście diagnostycznym HIV, przyłączających się do zaznaczonych fragmentów poniższej sekwencji genu odwrotnej transkryptazy wirusa HIV, wbudowanej w genom gospodarza.

  1. polF1 5′ CCCTACAATCCCCAAAGTCAAGGAGTAGTAGAA 3′
    polR1 5′ CTCTGGAAAGGTGAAGGGGCAGTAGTAATACA 3′
  2. polF1 5′ TTCTACTACTCCTTGACTTTGGGGATTGTAGGG 3′
    polR1 5′ TGTATTACTACTGCCCCTTCACCTTTCCAGAG 3′
  3. polF1 5′ CCCTACAATCCCCAAAGTCAAGGAGTAGTAGAA 3′
    polR1 5′ TGTATTACTACTGCCCCTTCACCTTTCCAGAG 3′
  4. polF1 5′ TTCTACTACTCCTTGACTTTGGGGATTGTAGGG 3′
    polR1 5′ CTCTGGAAAGGTGAAGGGGCAGTAGTAATACA 3′

14.3. (0–2)

Przed zabiegiem chirurgicznym pacjentowi wykonano testy na nosicielstwo wirusa HIV wykrywające przeciwciała anty-HIV. Wynik wyszedł dodatni. Pacjent nie znajduje się w żadnej z grup ryzyka zakażenia HIV. Według oficjalnych danych częstość występowania zakażenia HIV w Polsce wynosi ok. 40 osób na 100 tys.

Oblicz prawdopodobieństwo, że pacjent jest zakażony HIV, z uwzględnieniem czułości i specyficzności testu na przeciwciała anty-HIV. Zapisz obliczenia w wyznaczonych miejscach 1.–3.

  1. Oczekiwana liczba osób zakażonych HIV, u których wynik testu na przeciwciała anty-HIV będzie dodatni, wśród 100 tys. losowo przebadanych osób:
  2. Oczekiwana liczba osób zdrowych (niezakażonych), u których wynik testu na przeciwciała anty-HIV będzie dodatni, wśród 100 tys. losowo przebadanych osób:
  3. Prawdopodobieństwo, że pacjent z dodatnim wynikiem testu na przeciwciała anty-HIV jest zakażony HIV:

14.4. (0–1)

Oceń, czy poniższe interpretacje przedstawionych wyników badań trojga pacjentów są prawidłowe. Zaznacz T (tak), jeśli interpretacja jest prawidłowa, albo N (nie) – jeśli jest nieprawidłowa.

1. U pacjenta 1. wynik testu na przeciwciała anty-HIV był fałszywie dodatni, o czym świadczy wykluczenie zakażenia na podstawie wyników PCR. T N
2. Wyniki testu PCR dla pacjenta 2. są niewiarygodne ze względu na dodatni wynik w próbie kontrolnej negatywnej – należy powtórzyć badanie. T N
3. Dodatkowe badanie techniką PCR potwierdziło podejrzenie, że pacjent 3. jest zakażony HIV. T N

14.5. (0–1)

Wyjaśnij, dlaczego testy wykrywające przeciwciała anty-HIV nie nadają się do diagnostyki zakażeń HIV u noworodków i niemowląt urodzonych przez matki zakażone HIV. W odpowiedzi uwzględnij spodziewany wynik testu oraz funkcjonowanie układu odpornościowego matki.

14.6. (0–1)

Oceń, czy poniższe osoby znajdują się w grupie zwiększonego ryzyka zakażenia HIV. Zaznacz T (tak), jeśli się w niej znajdują, albo N (nie) – jeśli w niej się nie znajdują.

1. Osoby przebywające w jednym pomieszczeniu z osobami zakażonymi HIV, np. w pracy lub szkole. T N
2. Osoby narażone na częste ukąszenia komarów i innych owadów odżywiających się krwią. T N
3. Sąsiedzi osób zakażonych HIV, mieszkający w tym samym domu wielorodzinnym. T N
6

Matura Maj 2021, Poziom rozszerzony (Formuła 2015)Zadanie 19. (5 pkt)

Układ krążenia Choroby człowieka Dziedziczenie Ekspresja informacji genetycznej Zamknięte (np. testowe, prawda/fałsz) Podaj i uzasadnij/wyjaśnij Podaj/wymień

W strukturze genu obok fragmentów kodujących (eksonów) mogą występować elementy niekodujące, takie jak promotor lub introny.

W poniższej tabeli przedstawiono informacje na temat sześciu wybranych genów człowieka, oznaczonych numerami 1.–6., kodujących określone białka.

Oznaczenie genu Kodowane białko Oznaczenie chromosomu Wielkość genu (kpz DNA) Wielkość mRNA (kz)
1. α-globina 16 0,8 0,5
2. albumina 4 25,0 2,1
3. receptor LDL 19 45,0 5,5
4. kinaza zależna od cyklin 4 54,0 1,7
5. hydroksylaza fenyloalaninowa 12 90,0 2,4
6. dystrofina X 2000,0 16,0

kpz – tysiąc par zasad
kz – tysiąc zasad

Na podstawie: red. J. Bal, Biologia molekularna w medycynie, Warszawa 2013;
https://ghr.nlm.nih.gov/gene;
https://www.ncbi.nlm.nih.gov.

19.1. (0–1)

Podaj nazwę procesu, którego produktem jest pre-mRNA, oraz określ lokalizację tego procesu w komórce człowieka.

Nazwa procesu:
Lokalizacja procesu:

19.2. (0–1)

Wyjaśnij, z czego wynikają różnice między wielkościami genów a wielkościami cząsteczek mRNA, które im odpowiadają.

19.3. (0–1)

Podaj nazwę choroby, u podłoża której leży mutacja genu kodującego hydroksylazę fenyloalaninową, prowadząca do utraty funkcji tego enzymu niezbędnego w metabolizmie fenyloalaniny.

19.4. (0–1)

Spośród wymienionych w tabeli wybierz i zapisz oznaczenia pary genów, które mogą dziedziczyć się niezgodnie z II prawem Mendla. Odpowiedź uzasadnij, odwołując się do treści tego prawa oraz do lokalizacji wybranych genów w genomie.

19.5. (0–1)

Uzupełnij poniższe zdania tak, aby powstał poprawny opis dotyczący albumin. Podkreśl w każdym nawiasie właściwe określenie.

Albuminy to białka (rozpuszczalne / nierozpuszczalne) w wodzie, występujące głównie (w cytoplazmie erytrocytów / w osoczu krwi). Główną funkcją tych białek jest (transport tlenu / regulacja ciśnienia osmotycznego krwi).

7

Matura Maj 2020, Poziom podstawowy (Formuła 2007)Zadanie 19. (2 pkt)

Ekspresja informacji genetycznej Podaj i uzasadnij/wyjaśnij

Kod genetyczny to reguła, według której informacja genetyczna zapisana w sekwencji nukleotydów jest tłumaczona na sekwencję aminokwasów w białku. Jedną z cech kodu genetycznego jest możliwość zapisania jednego aminokwasu za pomocą różnych kodonów.

a)Określ, na którym etapie ekspresji informacji genetycznej – transkrypcji czy translacji – komórka bezpośrednio wykorzystuje kod genetyczny. Odpowiedź uzasadnij.
b)Podaj nazwę cechy kodu genetycznego opisanej w tekście i wykaż jej znaczenie dla zmniejszenia szkodliwych skutków mutacji zachodzących w materiale genetycznym.
8

Matura Maj 2020, Poziom rozszerzony (Formuła 2007)Zadanie 21. (2 pkt)

Prokarionty Ekspresja informacji genetycznej Podaj i uzasadnij/wyjaśnij Zamknięte (np. testowe, prawda/fałsz)

Na schematach A i B przedstawiono jeden z mechanizmów regulacji ekspresji genów u bakterii. Przedstawiają one różny sposób działania represora, zależnie od obecności związku X.

Na podstawie: J. Kączkowski, Biochemia roślin, Warszawa 1992.

a)Na podstawie schematu B opisz, w jaki sposób związek chemiczny X wpływa na ekspresję genów struktury u bakterii.
b)Wybierz spośród A–D i zaznacz właściwe dokończenie zdania.

Regulacja ekspresji genów u eukariontów

  1. ma taki sam przebieg jak u bakterii.
  2. odbywa się tylko na poziomie replikacji i transkrypcji.
  3. odbywa się na wielu różnych poziomach.
  4. jest możliwa dzięki wytworzeniu chromosomów.
9

Matura Maj 2020, Poziom rozszerzony (Formuła 2007)Zadanie 22. (2 pkt)

Budowa i funkcje komórki Ekspresja informacji genetycznej Podaj/wymień Podaj i uzasadnij/wyjaśnij

Na rysunku przedstawiono etapy pewnego procesu zachodzącego z udziałem siateczki śródplazmatycznej. Ten proces wymaga rozpoznawania sekwencji sygnałowej przez cząstki rozpoznające sygnał (SRP).

Na podstawie: P.C. Turner, A.G. McLennan, Krótkie wykłady. Biologia molekularna, Warszawa 2002.

a)Podaj nazwę i określ funkcję związku chemicznego oznaczonego na rysunku literą X.

Nazwa związku X:
Funkcja:

b)Określ, czy proces zilustrowany na rysunku zachodzi w organizmach prokariotycznych, czy – w eukariotycznych. Odpowiedź uzasadnij.
10

Matura Maj 2019, Poziom rozszerzony (Formuła 2015)Zadanie 17. (3 pkt)

Ekspresja informacji genetycznej Zamknięte (np. testowe, prawda/fałsz) Podaj i uzasadnij/wyjaśnij

W operonie tryptofanowym znajduje się pięć otwartych ramek odczytu (trpA–trpE) kodujących podjednostki enzymów uczestniczących w syntezie tryptofanu u bakterii.

Do sekwencji regulatorowych należy promotor, który znajduje się przed sekwencjami kodującymi trpA–trpE i stanowi miejsce wiązania polimerazy RNA. Obok promotora znajduje się operator, do którego przyłącza się aktywny represor. Białko represorowe jest aktywowane poprzez przyłączenie cząsteczki tryptofanu.

Na schemacie przedstawiono działanie operonu tryptofanowego w sytuacji, gdy komórka bakterii nie ma odpowiedniej ilości tego aminokwasu.

Na podstawie: E. Solomon, L. Berg, D. Martin, Biologia, Warszawa 2016.

17.1. (0–1)

Zaznacz poprawne dokończenie zdania – wybierz odpowiedź spośród A–B oraz odpowiedź spośród 1.–2.

Operon tryptofanowy podlega regulacji

A. pozytywnej, a cząsteczka tryptofanu pełni w nim funkcję 1. induktora.
B. negatywnej, 2. korepresora.

17.2. (0–1)

Opisz, korzystając z powyższego schematu, w jaki sposób będzie działać operon tryptofanowy w sytuacji, gdy komórka bakterii znajdzie się w środowisku, w którym ma dostęp do odpowiedniej ilości tryptofanu.

17.3. (0–1)

Na podstawie schematu określ, jak zmieni się funkcjonowanie operonu tryptofanowego na skutek mutacji w genie kodującym białko represorowe, której efektem jest uniemożliwienie przyłączenia się cząsteczki tryptofanu do tego białka.

Strony