Biologia - Informator CKE, Poziom rozszerzony (Formuła 2023) - Zadanie 14.

Kategoria: Metody badawcze i doświadczenia Ekspresja informacji genetycznej Choroby człowieka Układ immunologiczny Typ: Uzupełnij/narysuj wykres, schemat lub tabelę Zamknięte (np. testowe, prawda/fałsz) Podaj i uzasadnij/wyjaśnij

Współcześnie stosuje się dwie podstawowe metody wykrywania zakażeń HIV. Rutynowe badanie polega na wykrywaniu przeciwciał anty-HIV w surowicy pacjenta. W przypadku tej metody czułość badania, czyli prawdopodobieństwo otrzymania wyniku dodatniego u osoby chorej, tzn. wykrycia zakażenia, wynosi 100%, ale wynik dodatni otrzymuje się także dla 0,5% zdrowych osób – specyficzność wynosi 99,5%. Dlatego postawienie diagnozy zakażenia HIV wymaga potwierdzenia dodatkowym badaniem za pomocą metody PCR, wykrywającym gen odwrotnej transkryptazy wbudowany w genom gospodarza. Ta metoda jest teoretycznie bezbłędna pod warunkiem utrzymywania wysokich standardów pracy laboratoryjnej. Odpowiednie próby kontrolne służą sprawdzeniu, czy:

  • polimeraza DNA nie utraciła aktywności podczas przechowywania (kontrola pozytywna),
  • wszystkie odczynniki są wolne od wirusowego materiału genetycznego (kontrola negatywna).

Dla trzech pacjentów uzyskano dodatni wynik testu na obecność przeciwciał anty-HIV. Z tego powodu lekarz zlecił dodatkowe badanie z wykorzystaniem metody PCR, którego wyniki podsumowano w poniższej tabeli.

Próba
badawcza kontrolna pozytywna kontrolna negatywna
Pacjent 1. +
Pacjent 2. + + +
Pacjent 3. + +

Na podstawie: GenBank sekwencja nr KR861191.1; M. Fearon, The Laboratory Diagnosis of HIV Infections, „Can J Dis Med Microbiol” 16, 2005, s. 26–30;
D.S Boyle i inni, Rapid Detection of HIV-1 Proviral DNA for Early Infant Diagnosis Using Recombinase Polymerase Amplification, „mBio” 4, 2013, e00135–13;
S. Koblavi-Dème i inni, Sensitivity and Specificity of Human Immunodeficiency Virus Rapid Serologic Assays and Testing Algorithms in an Antenatal Clinic in Abidjan, Ivory Coast, „J Clin Microbiol” 39, 2001, s. 1808–1812.

14.1. (0–2)

Zaprojektuj doświadczenie PCR wykrywające DNA HIV wbudowane w genom gospodarza. Dla każdej z prób – badawczej, kontrolnej pozytywnej i kontrolnej negatywnej – wybierz wszystkie właściwe składniki mieszaniny reakcyjnej. Wpisz w tabelę znak „+”, jeśli składnik należy dodać do próby, albo znak „–”, jeśli ten składnik należy pominąć.

Próba
badawcza kontrolna pozytywna kontrolna negatywna
DNA genomowy wyizolowany od pacjenta
DNA genomowy wyizolowany z linii komórkowej zakażonej HIV
para specyficznych starterów
bufor zapewniający optymalne pH i stężenie jonów Mg2+
termostabilna polimeraza DNA
mieszanina deoksyrybonukleotydów

14.2. (0–1)

Wybierz spośród A–D i zaznacz prawidłowe sekwencje starterów polF1 i polR1, wykorzystywanych w teście diagnostycznym HIV, przyłączających się do zaznaczonych fragmentów poniższej sekwencji genu odwrotnej transkryptazy wirusa HIV, wbudowanej w genom gospodarza.

  1. polF1 5′ CCCTACAATCCCCAAAGTCAAGGAGTAGTAGAA 3′
    polR1 5′ CTCTGGAAAGGTGAAGGGGCAGTAGTAATACA 3′
  2. polF1 5′ TTCTACTACTCCTTGACTTTGGGGATTGTAGGG 3′
    polR1 5′ TGTATTACTACTGCCCCTTCACCTTTCCAGAG 3′
  3. polF1 5′ CCCTACAATCCCCAAAGTCAAGGAGTAGTAGAA 3′
    polR1 5′ TGTATTACTACTGCCCCTTCACCTTTCCAGAG 3′
  4. polF1 5′ TTCTACTACTCCTTGACTTTGGGGATTGTAGGG 3′
    polR1 5′ CTCTGGAAAGGTGAAGGGGCAGTAGTAATACA 3′

14.3. (0–2)

Przed zabiegiem chirurgicznym pacjentowi wykonano testy na nosicielstwo wirusa HIV wykrywające przeciwciała anty-HIV. Wynik wyszedł dodatni. Pacjent nie znajduje się w żadnej z grup ryzyka zakażenia HIV. Według oficjalnych danych częstość występowania zakażenia HIV w Polsce wynosi ok. 40 osób na 100 tys.

Oblicz prawdopodobieństwo, że pacjent jest zakażony HIV, z uwzględnieniem czułości i specyficzności testu na przeciwciała anty-HIV. Zapisz obliczenia w wyznaczonych miejscach 1.–3.

  1. Oczekiwana liczba osób zakażonych HIV, u których wynik testu na przeciwciała anty-HIV będzie dodatni, wśród 100 tys. losowo przebadanych osób:
  2. Oczekiwana liczba osób zdrowych (niezakażonych), u których wynik testu na przeciwciała anty-HIV będzie dodatni, wśród 100 tys. losowo przebadanych osób:
  3. Prawdopodobieństwo, że pacjent z dodatnim wynikiem testu na przeciwciała anty-HIV jest zakażony HIV:

14.4. (0–1)

Oceń, czy poniższe interpretacje przedstawionych wyników badań trojga pacjentów są prawidłowe. Zaznacz T (tak), jeśli interpretacja jest prawidłowa, albo N (nie) – jeśli jest nieprawidłowa.

1. U pacjenta 1. wynik testu na przeciwciała anty-HIV był fałszywie dodatni, o czym świadczy wykluczenie zakażenia na podstawie wyników PCR. T N
2. Wyniki testu PCR dla pacjenta 2. są niewiarygodne ze względu na dodatni wynik w próbie kontrolnej negatywnej – należy powtórzyć badanie. T N
3. Dodatkowe badanie techniką PCR potwierdziło podejrzenie, że pacjent 3. jest zakażony HIV. T N

14.5. (0–1)

Wyjaśnij, dlaczego testy wykrywające przeciwciała anty-HIV nie nadają się do diagnostyki zakażeń HIV u noworodków i niemowląt urodzonych przez matki zakażone HIV. W odpowiedzi uwzględnij spodziewany wynik testu oraz funkcjonowanie układu odpornościowego matki.

14.6. (0–1)

Oceń, czy poniższe osoby znajdują się w grupie zwiększonego ryzyka zakażenia HIV. Zaznacz T (tak), jeśli się w niej znajdują, albo N (nie) – jeśli w niej się nie znajdują.

1. Osoby przebywające w jednym pomieszczeniu z osobami zakażonymi HIV, np. w pracy lub szkole. T N
2. Osoby narażone na częste ukąszenia komarów i innych owadów odżywiających się krwią. T N
3. Sąsiedzi osób zakażonych HIV, mieszkający w tym samym domu wielorodzinnym. T N

Rozwiązanie

14.1. (0–2)

Zasady oceniania
2 pkt – za poprawny wybór składników we wszystkich trzech próbach.
1 pkt – za poprawny wybór składników wyłącznie w próbie badawczej.
0 pkt – za odpowiedź niespełniającą powyższych wymagań albo za brak odpowiedzi.

Rozwiązanie

Próba
badawcza kontrolna pozytywna kontrolna negatywna
DNA genomowy wyizolowany od pacjenta +
DNA genomowy wyizolowany z linii komórkowej zakażonej HIV +
para specyficznych starterów + + +
bufor zapewniający optymalne pH i stężenie jonów Mg2+ + + +
termostabilna polimeraza DNA + + +
mieszanina deoksyrybonukleotydów + + +

14.2. (0–1)

Zasady oceniania
1 pkt – za zaznaczenie właściwej pary sekwencji.
0 pkt – za odpowiedź niespełniającą powyższych wymagań albo za brak odpowiedzi.

Rozwiązanie C

14.3. (0–2)

Zasady oceniania
2 pkt – za poprawne obliczenie obu wartości oczekiwanych (1. i 2.) oraz (przybliżonego) prawdopodobieństwa (3.).
1 pkt – za poprawne obliczenie jedynie obu wartości oczekiwanych (1. i 2.) lub poprawne obliczenie samego prawdopodobieństwa (3.) w inny sposób niż sugerowany w poleceniu przy źle obliczonych wartościach oczekiwanych.
0 pkt – za odpowiedź niespełniającą powyższych wymagań albo za brak odpowiedzi.

Przykładowe rozwiązania

  1. Oczekiwana liczba osób zakażonych HIV, u których wynik testu na przeciwciała anty-HIV będzie dodatni wśród 100 tys. losowo przebadanych osób: 40 × 100% = 40.
  2. Oczekiwana liczba osób zdrowych (niezakażonych), u których wynik testu na przeciwciała anty-HIV będzie dodatni, wśród 100 tys. losowo przebadanych osób: (100 000 – 40) × 0,5% ≈ 500.
  3. Prawdopodobieństwo, że pacjent z dodatnim wynikiem testu na przeciwciała anty-HIV jest zakażony HIV: 40 / (40 + 500) ≈ 0,074 ≈ 7%.

14.4. (0–1)

Zasady oceniania
1 pkt – za trzy poprawne odpowiedzi.
0 pkt – za odpowiedź niespełniającą powyższych wymagań albo za brak odpowiedzi.

Rozwiązanie
TTT

14.5. (0–1)

Zasady oceniania
1 pkt – za poprawne wyjaśnienie, uwzględniające przechodzenie przez barierę łożyskową przeciwciał anty-HIV matki i w związku z tym pozytywny wynik testu niezależnie od stanu zdrowia dziecka.
0 pkt – za odpowiedź niespełniającą powyższych wymagań albo za brak odpowiedzi.

Przykładowe rozwiązania

  • Zakażona matka wytwarza przeciwciała anty-HIV, które przechodzą z jej surowicy przez łożysko do krwi płodu. Z tego powodu, niezależnie od tego, czy dziecko jest zakażone, czy – nie, spodziewany jest dodatni wynik testu.
  • W przeciwieństwie do podstawowego testu technika PCR wykrywa kwas nukleinowy wirusa wbudowany w genom gospodarza a nie – przeciwciała anty-HIV, które matka przekazuje przez łożysko dziecku. Zatem spodziewamy się wykryć te przeciwciała zarówno u zdrowego, jak i u zakażonego dziecka, a kwas nukleinowy wirusa – wyłącznie u zakażonego.

14.6. (0–1)

Zasady oceniania
1 pkt – za trzy poprawne odpowiedzi.
0 pkt – za odpowiedź niespełniającą powyższych wymagań albo za brak odpowiedzi.

Rozwiązanie
NNN

Wskazówki

Jest to obszerna wiązka zadań, sprawdzająca – w kontekście zakażenia HIV – umiejętności z zakresu szeroko pojętego rozumowania naukowego, w tym planowania eksperymentu i wnioskowania na podstawie jego wyników. Odwołuje się też do różnorodnej wiedzy szczegółowej, w tym z zakresu biotechnologii, biochemii, fizjologii człowieka i profilaktyki zakażeń wirusowych. Na szczególną uwagę zasługują dwa zadania – 14.1. i 14.3. Pierwsze sprawdza umiejętność zaplanowania eksperymentu, w tym dwóch prób kontrolnych – negatywnej i pozytywnej. Kolejne natomiast dotyczy prostych obliczeń statystycznych, ale ich wynik nie jest intuicyjny. Może być zaskoczeniem, że prawdopodobieństwo nosicielstwa HIV w wypadku dodatniego wyniku testu w przesiewowym badaniu immunoenzymatycznym wynosi zaledwie 7%. Świadomość względnie niskiej wartości prawdopodobieństwa zakażenia pod warunkiem pozytywnego wyniku testu przesiewowego pozwala zminimalizować stres pacjenta oczekującego na wyniki dodatkowych badań. Zadanie ułatwiono: wskazano wielkości, które należy otrzymać na pierwszym etapie obliczeń. Za każde z tych dwóch zadań zdający może uzyskać do dwóch punktów – zależnie od progu trudności, który udało mu się pokonać.

Komentarz wideo

Film do tego zadania jeszcze nie powstał. Kliknij poniższy przycisk, jeżeli chcesz aby Powtórka z biologii stworzyła komentarz wideo do tego zadania. Kliknięcie zwiększy szansę na powstanie takiego materiału w pierwszej kolejności.

Wysłano zgłoszenie. Subskrybuj nas aby być na bieżąco:

Więcej informacji o komentarzach wideo i ich dostępności Przeglądaj zadania z komentarzami wideo