Biologia - Informator CKE, Poziom rozszerzony (Formuła 2023)

Zadania z informatora maturalnego wydanego przez CKE w 2021 r.

Zadanie 1. (4 pkt)

Skład organizmów Budowa i funkcje komórki Układ immunologiczny Zamknięte (np. testowe, prawda/fałsz) Podaj i uzasadnij/wyjaśnij

U ssaków przeciwciała produkowane przez matkę mogą zostać przekazane potomstwu nie tylko w czasie życia płodowego, lecz także po urodzeniu. Zawarte w mleku matki przeciwciała klasy IgG mogą przedostać się przez nabłonek jelita do krwiobiegu niemowlęcia, ale przeciwciała klasy IgA są wchłaniane do enterocytów tylko w niewielkim stopniu, gdzie są następnie trawione.

Selektywny transport przeciwciał umożliwia białko FcRn, składające się z dwóch niekowalencyjnie związanych łańcuchów: ciężkiego H oraz lekkiego L. Przechodzi ono modyfikacje potranslacyjne – do co najmniej jednego aminokwasu są dołączane reszty cukrowe. Białko FcRn pełni funkcję receptora na powierzchni błony enterocytu, a jego powinowactwo do przeciwciał jest zależne od pH środowiska. U młodych ssaków treść dwunastnicy i jelita czczego ma kwaśny odczyn, a więc niższy niż fizjologiczne pH krwi. Transport przeciwciał zilustrowano na poniższym schemacie.

Na podstawie: M. Pyzik i inni, The Architect Behind the Immune and Nonimmune Functions of IgG and Albumin, „Journal of Immunlogy” 194, 2015, s. 4595–4603.

1.1. (0–1)

Wybierz i zaznacz makroelement, który może wejść w skład białka wyłącznie w wyniku modyfikacji potranslacyjnej.

  1. węgiel
  2. wodór
  3. azot
  4. tlen
  5. fosfor
  6. siarka

1.2. (0–1)

Na podstawie przedstawionych informacji określ najwyższą rzędowość struktury białka FcRn. Odpowiedź uzasadnij, odwołując się do cechy budowy tego białka.

1.3. (0–1)

Uzupełnij poniższe zdanie tak, aby powstał poprawny opis transportu przeciwciał przez komórkę nabłonka jelita z mleka matki do krwiobiegu niemowlęcia. W każdym nawiasie podkreśl właściwe określenie.

Przeciwciała dostają się z treści jelita niemowlęcia do wnętrza enterocytu na zasadzie (dyfuzji wspomaganej / endocytozy), a następnie wydostają się z niego do jego krwiobiegu w procesie (dyfuzji prostej / egzocytozy).

1.4. (0–1)

Wyjaśnij, dlaczego przez barierę jelitową do krwiobiegu niemowlęcia przedostają się wyłącznie przeciwciała klasy IgG, mimo że w mleku matki są zawarte także przeciwciała klasy IgA. W odpowiedzi uwzględnij rolę białka FcRn.

Zadanie 2. (4 pkt)

Oddychanie komórkowe Genetyka - pozostałe Metody badawcze i doświadczenia Zamknięte (np. testowe, prawda/fałsz) Podaj i uzasadnij/wyjaśnij

Organizmy modelowe są używane m.in. do badania zależności między genami, szlakami sygnałowymi i metabolizmem. Homeostaza lipidów i glukozy jest w podobny sposób kontrolowana u bezkręgowców i ssaków – za pomocą ścieżki sygnałowej uruchamianej przez insulinę. W celu określenia, czy dieta wysokotłuszczowa wpływa na metabolizm węglowodanów, lipidów i białek, przeprowadzono badania z wykorzystaniem identycznych genetycznie samic szczepu w1118 wywilżny karłowatej (Drosophila melanogaster) podzielonych na dwie grupy:

grupa I – osobniki hodowane na pożywce standardowej, wykorzystywanej w laboratoriach do hodowli wywilżny i zapewniającej jej wszystkie niezbędne do normalnego rozwoju składniki odżywcze;
grupa II – osobniki hodowane na pożywce standardowej, do której dodano oleju kokosowego (pożywka o dużej zawartości tłuszczów nasyconych).

Po tygodniu oznaczono zawartość określonych metabolitów u osobników należących do każdej z grup.

Na poniższych wykresach przedstawiono zawartość względną kwasów tłuszczowych (A) oraz zawartość względną wybranych metabolitów (B) w ciele much karmionych pożywką o wysokiej zawartości tłuszczów nasyconych, w porównaniu z zawartością tych związków w 1 mg masy ciała much karmionych pożywką standardową.

Informacja do wykresu
■ pożywka standardowa
□ pożywka o wysokiej zawartości tłuszczów nasyconych

  • Słupki błędu oznaczają błąd standardowy
  • Symbolem * określono wyniki testów istotności statystycznej dla porównań par średnich:

* p < 0,05
** p < 0,01
*** p < 0,001
**** p < 0,0001

Na podstawie: E.T. Heinrichsen i inni, Metabolic and transcriptional response to a high-fat diet in Drosophila melanogaster, „Molecular Metabolism” 3, 2014, s. 42–54.

2.1. (0–1)

Oceń, który z poniższych wniosków można sformułować na podstawie wyników przedstawionego doświadczenia. Zaznacz T, jeśli wniosek jest uprawniony, albo N - jeśli jest nieuprawniony.

1. Dieta bogata w tłuszcze powoduje wzrost średniej zawartości badanych kwasów tłuszczowych u wywilżny karłowatej. T N
2. Dieta bogata w tłuszcze przyczynia się u wywilżny karłowatej do wzrostu zawartości metabolitów cyklu Krebsa, w tym – średniej zawartości kwasu cytrynowego. T N
3. U wywilżny karłowatej dieta bogata w tłuszcze zwiększa średnią zawartość azotowych produktów przemiany materii – mocznika i kwasu moczowego. T N

2.2 (0–1)

Wyjaśnij, dlaczego doświadczenie przeprowadzono na genetycznie identycznych osobnikach tej samej płci Drosophila melanogaster – należących do jednego szczepu w1118.

2.3. (0–1)

Określ, która grupa Drosophila melanogaster – I czy II – stanowiła w opisanym doświadczeniu próbę kontrolną. Odpowiedź uzasadnij, odwołując się do roli tej próby w interpretacji wyników doświadczenia.

2.4. (0–1)

Uzupełnij poniższe zdania tak, aby stanowiły poprawną interpretację uzyskanych wyników opisanego doświadczenia. W każdym nawiasie podkreśl właściwe określenie.

Zaobserwowany u osobników wywilżny karłowatej odżywiających się pokarmem bogatotłuszczowym (spadek / wzrost) poziomu kwasu mlekowego świadczy o (zmniejszeniu / zwiększeniu) intensywności przemian kwasu pirogronowego w cytozolu ich komórek. Zaobserwowane zaburzenia w metabolizmie kwasu pirogronowego mogą być efektem zwiększonej intensywności (redukcji / utleniania) kwasów tłuszczowych, jako że w wyniku tego procesu powstaje acetylokoenzym A, dostarczający grupy acetylowe do cyklu Krebsa.

Zadanie 3. (3 pkt)

Budowa i funkcje komórki Metody badawcze i doświadczenia Zamknięte (np. testowe, prawda/fałsz)

Paklitaksel to związek chemiczny wyizolowany z kory cisa krótkolistnego (Taxus brevifolia). Stosuje się go w leczeniu m.in. raka sutka, jajnika i płuc. Działanie paklitakselu polega na stabilizacji mikrotubul i zahamowaniu ich depolimeryzacji, co uniemożliwia ich skracanie. Apigenina jest flawonem występującym m.in. w kwiatach rumianku, pietruszce i selerze.

Poniżej przedstawiono wykres ilustrujący odsetek komórek nowotworowych, które pozostały żywe po 24 godzinach od podania paklitakselu (Pak), apigeniny (Api) lub obu związków razem (Pak i Api).

Słupki błędów wskazują odchylenie standardowe, a symbol ** oznacza, że wartość średnia dla próby badawczej różniła się istotnie statystycznie od wartości średniej uzyskanej w próbie kontrolnej (p < 0,01).

Na podstawie: Y. Xu i inni, Synergistic Effects of Apigenin and Paclitaxel on Apoptosis of Cancer Cells, „PLoS ONE" 6(12), 2011, s. 1-12.

3.1. (0–1)

Dokończ zdanie. Zaznacz odpowiedź A, B albo C oraz jej uzasadnienie 1., 2. albo 3.

Paklitaksel jest przyczyną zatrzymania cyklu komórkowego w fazie

A. S, ponieważ 1. chromatydy siostrzane nie mogą być rozdzielone.
B. G2, 2. hamuje on syntezę DNA.
C. M, 3. powoduje on wydłużanie mikrotubul.

3.2. (0–2)

Uzupełnij poniższe zdania tak, aby powstał poprawny opis interpretacji przedstawionego wykresu. W każdym nawiasie podkreśl właściwe określenie.

Paklitaksel i apigenina podane razem powodują, że po 24 godzinach przeżywa średnio około (50% / 80%) komórek. Na podstawie wykresu można stwierdzić, że podanie paklitakselu i apigeniny (razem / oddzielnie) będzie – średnio rzecz biorąc – skuteczniejsze w terapii raka niż podawanie ich (razem / oddzielnie). Istotność statystyczna różnic w przeżywalności komórek we wszystkich wariantach badawczych w stosunku do próby kontrolnej (pozytywnej / negatywnej) wynosiła p < 0,01.

Zadanie 4. (2 pkt)

Prokarionty Choroby człowieka Zamknięte (np. testowe, prawda/fałsz)

Gruźlica jest chorobą zakaźną wywołaną przez bakterie – prątki gruźlicy (Mycobacterium tuberculosis). Najczęściej zakażenie obejmuje płuca, ale prątki gruźlicy mogą docierać do wszystkich narządów i tkanek, a w pewnych okolicznościach – wywołać chorobę, która rozwija się u 5–10% osób zakażonych prątkami.

Szczepionka BCG (Bacillus Calmette-Guérin) zawiera żywe, osłabione prątki bydlęce (Mycobacterium bovis). Szczepionki BCG są uważane za bezpieczne. Odczyny poszczepienne występują bardzo rzadko, a jeżeli występują, to są niebolesne oraz mają tendencję do samowygojenia. Z uwagi na możliwość rozwoju infekcji, szczepionek zawierających żywe bakterie nie należy jednak aplikować osobom o obniżonej odporności, np. przyjmującym leki immunosupresyjne po przeszczepach narządów. Szczepienie BCG chroni niemowlęta i dzieci przed najcięższą postacią gruźlicy, tj. gruźliczym zapaleniem opon mózgowo-rdzeniowych. Jednakże tylko część badań wykazała skuteczność szczepionki BCG w zapobieganiu gruźlicy płuc.

Prątki mają nietypową budowę ściany komórkowej – odmienną zarówno od bakterii Gram- -ujemnych, jak i Gram-dodatnich. Zewnętrzna błona jest stosunkowo gruba i leży na warstwie lipidów złożonych głównie z kwasu mikolowego. Te dwie zewnętrzne warstwy tworzą barierę nieprzepuszczalną dla wielu leków przeciwbakteryjnych, np. dla powszechnie stosowanych antybiotyków β-laktamowych.

Na podstawie: szczepienia.pzh.gov.pl; M. Palmer i inni, Biochemical Pharmacology, University of Waterloo 2012.

4.1. (0–1)

Poniższym schematom (A–C) budowy struktur otaczających komórkę prokariotyczną przyporządkuj odpowiednią grupę bakterii spośród 1.–4.

  1. prątki
  2. bakterie Gram-ujemne
  3. bakterie Gram-dodatnie
  4. bakterie pozbawione ściany komórkowej

4.2. (0–1)

Oceń, czy poniższe informacje dotyczące gruźlicy i jej zapobiegania są prawdziwe. Zaznacz P, jeśli informacja jest prawdziwa, albo F – jeśli jest fałszywa.

1. Zakażenie prątkiem gruźlicy najczęściej przebiega bezobjawowo. P F
2. Szczepionka BCG może być niebezpieczna dla osób z obniżoną odpornością. P F
3. Podstawowym celem podawania szczepionki BCG jest zapobieganie gruźlicy płuc. P F

Zadanie 5. (3 pkt)

Grzyby Oddychanie komórkowe Uzupełnij/narysuj wykres, schemat lub tabelę Podaj i uzasadnij/wyjaśnij

W celu wykazania, że intensywność fermentacji alkoholowej przeprowadzanej przez drożdże piekarnicze zależy od warunków środowiskowych, uczniowie przygotowali trzy różne zestawy doświadczalne (A–C), przedstawione na rysunku poniżej. W skład każdego z nich wchodziła kolba wypełniona zawiesiną drożdży w wodnym roztworze cukru (glukozy), ale inny był sposób zamknięcia naczynia lub kolba pozostała otwarta. Wszystkie trzy zestawy były regularnie wytrząsane i utrzymywane w temperaturze 30°C – optymalnej dla wzrostu drożdży.

5.1. (0–2)

Określ, w którym zestawie (A–C) fermentacja alkoholowa zachodziła z najmniejszą intensywnością, a w którym – z największą. Odpowiedź uzasadnij, odwołując się do warunków panujących w każdym z zestawów.

Fermentacja zachodziła z:

  1. najmniejszą intensywnością w zestawie , ponieważ
  2. największą intensywnością w zestawie , ponieważ

5.2. (0–1)

Uzupełnij poniższy schemat reakcji fermentacji alkoholowej – wybierz właściwe związki chemiczne spośród wymienionych poniżej i wpisz je w odpowiednie miejsca.

2 pirogronian
2 dwutlenek węgla
2 NADH + 2H+
2 ATP

Zadanie 6. (4 pkt)

Metody badawcze i doświadczenia Protisty Sformułuj wnioski, hipotezę lub zaplanuj doświadczenie Podaj i uzasadnij/wyjaśnij

Zielenica Scenedesmus subspicatus może być jednokomórkowa lub tworzyć 2-, 4- lub 8-komórkowe kolonie. Postawiono hipotezę, że forma morfologiczna glonu wynika z presji roślinożercy.

Aby przetestować tę hipotezę, przeprowadzono następujący eksperyment. Dodano do wody sole mineralne i rozpoczęto hodowlę S. subspicatus w warunkach sztucznego oświetlenia i stałej temperatury równej 20°C. Po sześciu dniach populacja składała się prawie wyłącznie z formy jednokomórkowej o rozmiarach 6–8 × 4–5 μm w zagęszczeniu około 20 tys. komórek/ml. Na tym etapie hodowlę podzielono na cztery części i umieszczono w osobnych naczyniach o objętości 100 ml. Do dwóch z nich dodano po jednym osobniku Daphnia magna – skorupiaka o wielkości około 3 mm, który w warunkach naturalnych żywi się fitoplanktonem. Pozostałe warunki hodowli nie uległy zmianie. We wszystkich czterech próbach codziennie sprawdzano gęstość hodowli oraz udział poszczególnych form morfologicznych.

Wyniki eksperymentu przedstawiono na poniższych wykresach w postaci średnich oraz zakresu zmienności w dwóch powtórzeniach.

Na podstawie: D.O Hessen, E. Van Donk, Morphological changes in Scenedesmus induced by substances released from Daphnia, „Archiv für Hydrobiologie” 127, 1993, s. 129–129.

6.1. (0–1)

Sformułuj wniosek na podstawie przedstawionych wyników doświadczenia.

6.2. (0–1)

Wyjaśnij, dlaczego prowadzono hodowlę S. subspicatus także bez obecności D. magna. W odpowiedzi uwzględnij znaczenie tej próby w interpretacji wyników doświadczenia.

6.3. (0–2)

Wyjaśnij, dlaczego dla utrzymania hodowli S. subspicatus konieczne jest:

  1. włączenie oświetlenia,
  2. dodanie do wody soli mineralnych.

Zadanie 7. (4 pkt)

Tkanki roślinne Zamknięte (np. testowe, prawda/fałsz)

Safranina i zieleń świetlista wybarwiają związki budulcowe ścian komórkowych roślin na różne kolory. Jednoczesne użycie obu barwników pomaga ocenić stopień zdrewnienia ścian komórkowych różnych tkanek.

Na zdjęciu przedstawiono wybarwiony za pomocą safraniny i zieleni świetlistej przekrój przez wiązkę przewodzącą kukurydzy – rośliny jednoliściennej. Literami A, B i C oznaczono elementy trzech tkanek. Ściany komórkowe elementów A i C wybarwiły się na czerwono, a elementu B – na niebieskozielono.

Na podstawie: https://upload.wikimedia.org/ wikipedia/commons/f/f6/Zea1_Dutch_txt.jpg

7.1. (0–2)

Oznaczeniom literowym A–C na zdjęciu przyporządkuj spośród 1.–4. odpowiednie nazwy elementów tkanek budujących tę wiązkę.

  1. człon naczynia
  2. człon rurki sitowej
  3. komórka miękiszowa
  4. włókno sklerenchymatyczne

7.2. (0–1)

Uzupełnij poniższe zdanie tak, aby powstał poprawny opis budowy elementów wiązki przewodzącej. W każdym nawiasie podkreśl właściwe określenie.

Człony rurek sitowych można zidentyfikować po tym, że ich ściany komórkowe są znacznie (cieńsze / grubsze) od ścian członów naczyń oraz od komórek (sklerenchymy / miękiszu), a ponadto (towarzyszą / nie towarzyszą) im komórki przyrurkowe.

7.3. (0–1)

Dokończ zdanie. Zaznacz odpowiedź A albo B oraz jej uzasadnienie 1., 2. albo 3.

Na podstawie zdjęcia można wnioskować, że lignina wybarwiła się na kolor

A. czerwony, ponieważ ligniną
są wysycone ściany
komórek
1. członów naczyń i sklerenchymy.
2. rurek sitowych i miękiszu.
B. niebieskozielony,
3. członów naczyń i rurek sitowych.

Zadanie 8. (2 pkt)

Fizjologia roślin Zamknięte (np. testowe, prawda/fałsz)

Pobrany przez opuncję figową (Opuntia ficus-indica) dwutlenek węgla jest wstępnie wiązany do kwasu fosfoenolopirogronowego (PEP) i magazynowany w postaci czterowęglowego jabłczanu w wakuolach komórek miękiszu asymilacyjnego. Gdy w tych komórkach możliwe jest wytworzenie siły asymilacyjnej, jabłczan jest transportowany do cytozolu i podlega reakcji dekarboksylacji. Pochodzący z tej reakcji dwutlenek węgla wiązany jest w cyklu Calvina-Bensona w chloroplastach tej komórki.

Na poniższych wykresach przedstawiono bilans pochłaniania CO2, będący różnicą między pochłanianiem CO2 z atmosfery a jego wydzielaniem (wykres 1.), oraz przewodność szparkową, która wyraża natężenie transpiracji poprzez aparaty szparkowe (wykres 2.) u opuncji figowej (Opuntia ficus-indica). Obserwację prowadzono przez 24 godziny, w czasie której roślina była zarówno wystawiona na działanie światła, jak i przetrzymywana w ciemności.

Na podstawie: L. Taiz, E. Zeiger, Plant Physiology, Sunderland 2006, s. 187.

8.1. (0–1)

Dokończ zdanie. Zaznacz odpowiedź A albo B oraz jej uzasadnienie 1., 2. albo 3.

Na podstawie przedstawionych informacji można stwierdzić, że opuncja figowa, ze względu na rodzaj przeprowadzanej fotosyntezy, należy do roślin typu

A. C4, ponieważ
1. wtórnym produktem wiązania CO2 w chloroplastach jest związek czterowęglowy.
2. u tej rośliny wstępne wiązanie CO2 zachodzi w nocy, a wiązanie CO2 w cyklu Calvina-Bensona – w dzień.
B. CAM,
3. u tej rośliny pierwotne i wtórne wiązanie CO2 jest rozdzielone przestrzennie – zachodzi w różnych typach komórek.

8.2. (0–1)

Oceń, czy poniższe informacje dotyczące opuncji figowej są prawdziwe. Zaznacz P, jeśli informacja jest prawdziwa, albo F – jeśli jest fałszywa.

1. W nocy, gdy aparaty szparkowe pozostają otwarte, utrata CO2 pochodzącego z mitochondrialnych procesów oddychania przewyższa ilość pochłanianego CO2. P F
2. Zamknięte w ciągu dnia aparaty szparkowe ograniczają utratę wody na drodze transpiracji, dzięki czemu możliwe staje się prowadzenie oszczędnej gospodarki wodnej. P F
3. Zamknięcie aparatów szparkowych w ciągu dnia w dużym stopniu ogranicza utratę odłączonego od kwasu jabłkowego CO2 do atmosfery. P F

Zadanie 9. (2 pkt)

Stawonogi Podaj i uzasadnij/wyjaśnij Zamknięte (np. testowe, prawda/fałsz)

U owadów i wijów funkcję transportu gazów oddechowych oraz wymiany gazowej pełni układ tchawkowy. System rozgałęzionych tchawek doprowadza tlen do każdej komórki ciała.

Na rysunku przedstawiono fragment układu tchawkowego owada.

Na podstawie: A. Czubaj i inni, Biologia, Warszawa 1994, s. 273.

9.1. (0–1)

Z wykorzystaniem informacji na rysunku przedstaw, w jaki sposób tracheole usprawniają wymianę gazową między tchawkami a komórkami ciała.

9.2. (0–1)

Oceń, czy poniższe informacje dotyczące porównania owadów i wijów są prawdziwe. Zaznacz P, jeśli informacja jest prawdziwa, albo F – jeśli jest fałszywa.

1. Owady, podobnie jak wije, wykazują metamerię heteronomiczną. P F
2. Zarówno owady, jak i wije mają jedną parę czułków. P F
3. Owady przechodzą rozwój prosty lub złożony, a wije – tylko prosty. P F

Zadanie 10. (3 pkt)

Układ kostny i mięśniowy Układ oddechowy Podaj i uzasadnij/wyjaśnij Zamknięte (np. testowe, prawda/fałsz) Uzupełnij/narysuj wykres, schemat lub tabelę

Mioglobina jest białkiem występującym w mięśniach kręgowców. U ssaków nurkujących służy jako magazyn tlenu: pozwala na pracę mięśni w warunkach chwilowego niedotlenienia całego organizmu. Natomiast obecność mioglobiny w mięśniach pozostałych ssaków przede wszystkim wpływa na efektywność dyfuzji tlenu z krwi do mięśni.

Na poniższym wykresie przedstawiono powinowactwo mioglobiny do tlenu oraz powinowactwo hemoglobiny do tlenu w pięciu różnych pH.

Na podstawie: R.G. Garrett, C.M. Grisham, Biochemistry, University of Virginia 2010, s. 474; J.M. Berg, J.L. Tymoczko, L. Stryer, Biochemia, Warszawa 2009, s. 183–193.

10.1. (0–1)

Określ, jaki wpływ na dyfuzję tlenu z krwi do włókien mięśniowych ma mioglobina występująca w cytozolu tych komórek. Odpowiedź uzasadnij, odnosząc się do danych przedstawionych na wykresie.

10.2. (0–1)

Uzupełnij poniższe zdanie tak, aby w poprawny sposób opisywało ono procesy wymiany gazowej zachodzące w płucach człowieka. W każdym nawiasie podkreśl właściwe określenie.

Podczas wymiany gazowej w płucach człowieka dyfuzja CO2 z krwi do pęcherzyków płucnych jest przyczyną (wzrostu / spadku) pH krwi, a dzięki temu następuje (wzrost / spadek) powinowactwa hemoglobiny do tlenu.

10.3. (0–1)

Uzupełnij poniższy schemat tak, aby poprawnie ilustrował drogę tlenu z powietrza pęcherzykowego, aż do jego wykorzystania w procesie tlenowego oddychania wewnątrzkomórkowego. Wpisz we właściwe miejsca wymienione poniżej nazwy.

oksymioglobina
oksyhemoglobina
mitochondrium

tlen cząsteczkowy →

Zadanie 11. (3 pkt)

Ewolucjonizm i historia życia na ziemi Metody badawcze i doświadczenia Zamknięte (np. testowe, prawda/fałsz)

Białko prionowe (PrP) w neuronach ssaków może występować w dwóch formach przestrzennych: sfałdowanej prawidłowo oraz sfałdowanej nieprawidłowo. Nie poznano dotąd funkcji formy prawidłowej, natomiast forma nieprawidłowa jest przyczyną chorób prionowych, np. choroby Creutzfeldta-Jakoba.

W celu określenia funkcji białka PrP w neuronie hodowano myszy o genotypie dzikim (PrP+/+) oraz myszy z nieaktywnymi obiema kopiami genu kodującego badane białko (PrP-/-). Z myszy wyizolowano neurony i zmierzono czas trwania depolaryzacji i repolaryzacji. Wyniki eksperymentu przedstawiono na poniższym wykresie.

Informacja do wykresu

Średni czas depolaryzacji i repolaryzacji wraz z błędem standardowym. Symbolem * oznaczono próbę, dla której średnia różni się istotnie statystycznie od średniej w odpowiedniej próbie kontrolnej (p < 0,001).

W plemieniu Fore z Papui-Nowej Gwinei dawniej występowała choroba kuru, będąca odmianą choroby Creutzfeldta-Jakoba. Choroba rozprzestrzeniała się, ponieważ w tym plemieniu praktykowano rytualny kanibalizm zmarłych. Po zaprzestaniu tych praktyk ustały przypadki nowych zachorowań. U części członków tego plemienia wykryto allel genu kodującego PrP − całkowicie eliminujący ryzyko zachorowania na chorobę Creutzfeldta-Jakoba. Tego allelu nie znaleziono dotychczas w innych ludzkich populacjach.

Na podstawie: H. Khosravani i inni, Prion protein attenuates excitotoxicity by inhibiting NMDA receptors, „Journal Cell Biology” 181, 2008, s. 551–565;
E.A. Asante i inni, A naturally occurring variant of the human prion protein completely prevents prion disease, „Nature” 522, 2015, s. 478–48

11.1. (0–2)

Uzupełnij poniższe zdania tak, aby powstał poprawny wniosek dotyczący wpływu białka PrP na czas depolaryzacji i repolaryzacji neuronu. W każdym nawiasie podkreśl właściwe określenie.

Białko PrP (skraca / wydłuża) średni czas (depolaryzacji / repolaryzacji) błony neuronu, ponieważ średni czas w próbie badawczej był istotnie statystycznie (krótszy / dłuższy) od czasu w próbie kontrolnej. Natomiast ustalenie, czy białko PrP skraca, czy – wydłuża średni czas (depolaryzacji / repolaryzacji), nie jest możliwe ze względu na zbyt małe różnice między średnimi w próbie badawczej i kontrolnej.

11.2. (0–1)

Oceń, czy poniższe informacje dotyczące choroby kuru są prawdziwe. Zaznacz P, jeśli informacja jest prawdziwa, albo F – jeśli jest fałszywa.

1. Korzystne mutacje chroniące przed kuru powstały w DNA w wyniku rytualnego kanibalizmu osób zmarłych na tę chorobę. P F
2. Allel chroniący przed zachorowaniem na kuru prawdopodobnie zwiększył swoją częstość wśród ludu Fore dzięki doborowi naturalnemu. P F
3. Wskutek zaprzestania kanibalizmu wśród Fore allel chroniący przed kuru stracił znaczenie adaptacyjne, ale może się utrzymać dzięki dryfowi genetycznemu. P F

Zadanie 12. (2 pkt)

Ekspresja informacji genetycznej Zamknięte (np. testowe, prawda/fałsz)

Uzupełnij poniższe zdania tak, aby powstał poprawny opis zjawiska alternatywnego składania eksonów. W każdym nawiasie podkreśl właściwe określenie.

W wyniku alternatywnego składania eksonów może powstać (tylko jeden rodzaj / wiele rodzajów) mRNA. Dzięki temu w organizmach eukariotycznych obserwuje się znacznie (mniej / więcej) różnych białek w porównaniu z liczbą genów w genomie. Ze względu na to, że ten proces nie zachodzi w organizmach prokariotycznych, gdy planuje się otrzymanie eukariotycznego białka w komórkach bakterii, należy przeprowadzić odwrotną (transkrypcję / translację) mRNA, która pozwala uzyskać gen pozbawiony (eksonów / intronów).

Zadanie 13. (4 pkt)

Dziedziczenie Podaj/wymień Podaj i uzasadnij/wyjaśnij

Umaszczenie świń rasy duroc jest warunkowane przez dwie pary alleli genów autosomalnych (B i b oraz D i d) dziedziczonych niezależnie i współdziałających ze sobą. U osobników tej rasy występują trzy rodzaje umaszczenia: ciemnorudy, piaskowy i biały. Do wytworzenia barwnika ciemnorudego konieczny jest co najmniej jeden allel dominujący z każdej pary. Podwójne homozygoty recesywne są białe, natomiast umaszczenie piaskowe mają osobniki, w których genotypie występują dwa allele recesywne tylko jednego z genów warunkujących umaszczenie.

Na podstawie: B. Kosowska, Genetyka ogólna i weterynaryjna, Wrocław 2010, s. 25.

13.1. (0–1)

Zapisz, stosując podane w tekście oznaczenia alleli genów odpowiedzialnych za umaszczenie, genotypy pary świń rasy duroc – piaskowej samicy i piaskowego samca, których potomstwo zawsze będzie ciemnorude.

Genotyp samicy:
Genotyp samca:

13.2. (0–3)

Określ prawdopodobieństwo, że kolejny potomek ciemnorudej samicy i białego samca, których potomstwo stanowią prosięta ciemnorude, piaskowe oraz białe, będzie miał umaszczenie piaskowe. Odpowiedź uzasadnij, zapisując krzyżówkę genetyczną lub obliczenia z komentarzem przedstawiającym tok rozumowania.

Zadanie 14. (8 pkt)

Metody badawcze i doświadczenia Ekspresja informacji genetycznej Choroby człowieka Układ immunologiczny Uzupełnij/narysuj wykres, schemat lub tabelę Zamknięte (np. testowe, prawda/fałsz) Podaj i uzasadnij/wyjaśnij

Współcześnie stosuje się dwie podstawowe metody wykrywania zakażeń HIV. Rutynowe badanie polega na wykrywaniu przeciwciał anty-HIV w surowicy pacjenta. W przypadku tej metody czułość badania, czyli prawdopodobieństwo otrzymania wyniku dodatniego u osoby chorej, tzn. wykrycia zakażenia, wynosi 100%, ale wynik dodatni otrzymuje się także dla 0,5% zdrowych osób – specyficzność wynosi 99,5%. Dlatego postawienie diagnozy zakażenia HIV wymaga potwierdzenia dodatkowym badaniem za pomocą metody PCR, wykrywającym gen odwrotnej transkryptazy wbudowany w genom gospodarza. Ta metoda jest teoretycznie bezbłędna pod warunkiem utrzymywania wysokich standardów pracy laboratoryjnej. Odpowiednie próby kontrolne służą sprawdzeniu, czy:

  • polimeraza DNA nie utraciła aktywności podczas przechowywania (kontrola pozytywna),
  • wszystkie odczynniki są wolne od wirusowego materiału genetycznego (kontrola negatywna).

Dla trzech pacjentów uzyskano dodatni wynik testu na obecność przeciwciał anty-HIV. Z tego powodu lekarz zlecił dodatkowe badanie z wykorzystaniem metody PCR, którego wyniki podsumowano w poniższej tabeli.

Próba
badawcza kontrolna pozytywna kontrolna negatywna
Pacjent 1. +
Pacjent 2. + + +
Pacjent 3. + +

Na podstawie: GenBank sekwencja nr KR861191.1; M. Fearon, The Laboratory Diagnosis of HIV Infections, „Can J Dis Med Microbiol” 16, 2005, s. 26–30;
D.S Boyle i inni, Rapid Detection of HIV-1 Proviral DNA for Early Infant Diagnosis Using Recombinase Polymerase Amplification, „mBio” 4, 2013, e00135–13;
S. Koblavi-Dème i inni, Sensitivity and Specificity of Human Immunodeficiency Virus Rapid Serologic Assays and Testing Algorithms in an Antenatal Clinic in Abidjan, Ivory Coast, „J Clin Microbiol” 39, 2001, s. 1808–1812.

14.1. (0–2)

Zaprojektuj doświadczenie PCR wykrywające DNA HIV wbudowane w genom gospodarza. Dla każdej z prób – badawczej, kontrolnej pozytywnej i kontrolnej negatywnej – wybierz wszystkie właściwe składniki mieszaniny reakcyjnej. Wpisz w tabelę znak „+”, jeśli składnik należy dodać do próby, albo znak „–”, jeśli ten składnik należy pominąć.

Próba
badawcza kontrolna pozytywna kontrolna negatywna
DNA genomowy wyizolowany od pacjenta
DNA genomowy wyizolowany z linii komórkowej zakażonej HIV
para specyficznych starterów
bufor zapewniający optymalne pH i stężenie jonów Mg2+
termostabilna polimeraza DNA
mieszanina deoksyrybonukleotydów

14.2. (0–1)

Wybierz spośród A–D i zaznacz prawidłowe sekwencje starterów polF1 i polR1, wykorzystywanych w teście diagnostycznym HIV, przyłączających się do zaznaczonych fragmentów poniższej sekwencji genu odwrotnej transkryptazy wirusa HIV, wbudowanej w genom gospodarza.

  1. polF1 5′ CCCTACAATCCCCAAAGTCAAGGAGTAGTAGAA 3′
    polR1 5′ CTCTGGAAAGGTGAAGGGGCAGTAGTAATACA 3′
  2. polF1 5′ TTCTACTACTCCTTGACTTTGGGGATTGTAGGG 3′
    polR1 5′ TGTATTACTACTGCCCCTTCACCTTTCCAGAG 3′
  3. polF1 5′ CCCTACAATCCCCAAAGTCAAGGAGTAGTAGAA 3′
    polR1 5′ TGTATTACTACTGCCCCTTCACCTTTCCAGAG 3′
  4. polF1 5′ TTCTACTACTCCTTGACTTTGGGGATTGTAGGG 3′
    polR1 5′ CTCTGGAAAGGTGAAGGGGCAGTAGTAATACA 3′

14.3. (0–2)

Przed zabiegiem chirurgicznym pacjentowi wykonano testy na nosicielstwo wirusa HIV wykrywające przeciwciała anty-HIV. Wynik wyszedł dodatni. Pacjent nie znajduje się w żadnej z grup ryzyka zakażenia HIV. Według oficjalnych danych częstość występowania zakażenia HIV w Polsce wynosi ok. 40 osób na 100 tys.

Oblicz prawdopodobieństwo, że pacjent jest zakażony HIV, z uwzględnieniem czułości i specyficzności testu na przeciwciała anty-HIV. Zapisz obliczenia w wyznaczonych miejscach 1.–3.

  1. Oczekiwana liczba osób zakażonych HIV, u których wynik testu na przeciwciała anty-HIV będzie dodatni, wśród 100 tys. losowo przebadanych osób:
  2. Oczekiwana liczba osób zdrowych (niezakażonych), u których wynik testu na przeciwciała anty-HIV będzie dodatni, wśród 100 tys. losowo przebadanych osób:
  3. Prawdopodobieństwo, że pacjent z dodatnim wynikiem testu na przeciwciała anty-HIV jest zakażony HIV:

14.4. (0–1)

Oceń, czy poniższe interpretacje przedstawionych wyników badań trojga pacjentów są prawidłowe. Zaznacz T (tak), jeśli interpretacja jest prawidłowa, albo N (nie) – jeśli jest nieprawidłowa.

1. U pacjenta 1. wynik testu na przeciwciała anty-HIV był fałszywie dodatni, o czym świadczy wykluczenie zakażenia na podstawie wyników PCR. T N
2. Wyniki testu PCR dla pacjenta 2. są niewiarygodne ze względu na dodatni wynik w próbie kontrolnej negatywnej – należy powtórzyć badanie. T N
3. Dodatkowe badanie techniką PCR potwierdziło podejrzenie, że pacjent 3. jest zakażony HIV. T N

14.5. (0–1)

Wyjaśnij, dlaczego testy wykrywające przeciwciała anty-HIV nie nadają się do diagnostyki zakażeń HIV u noworodków i niemowląt urodzonych przez matki zakażone HIV. W odpowiedzi uwzględnij spodziewany wynik testu oraz funkcjonowanie układu odpornościowego matki.

14.6. (0–1)

Oceń, czy poniższe osoby znajdują się w grupie zwiększonego ryzyka zakażenia HIV. Zaznacz T (tak), jeśli się w niej znajdują, albo N (nie) – jeśli w niej się nie znajdują.

1. Osoby przebywające w jednym pomieszczeniu z osobami zakażonymi HIV, np. w pracy lub szkole. T N
2. Osoby narażone na częste ukąszenia komarów i innych owadów odżywiających się krwią. T N
3. Sąsiedzi osób zakażonych HIV, mieszkający w tym samym domu wielorodzinnym. T N

Zadanie 15. (1 pkt)

Inżynieria i badania genetyczne Podaj i uzasadnij/wyjaśnij

Indukowane pluripotencjalne komórki macierzyste (komórki iPS) są pozyskiwane z komórek somatycznych, takich jak fibroblasty. W 2014 r. po raz pierwszy wszczepiono warstwę barwnikową siatkówki przygotowaną z komórek iPS w ramach leczenia zwyrodnienia plamki żółtej. Wcześniej nie stosowano przeszczepu siatkówki w leczeniu tego schorzenia.

Na podstawie: https://www.riken.jp/pr/news/2014/20140918_1/

Uzasadnij, że wszczepienie warstwy barwnikowej siatkówki otrzymanej z komórek iPS pacjenta, a nie – innego dawcy, jest korzystne dla tego pacjenta.

Zadanie 16. (2 pkt)

Ewolucjonizm i historia życia na ziemi Kręgowce Uzupełnij/narysuj wykres, schemat lub tabelę Zamknięte (np. testowe, prawda/fałsz)

Przez długi czas uważano, że walenie (Cetacea) – wodne ssaki, do których zaliczamy m.in. delfina butlonosego i płetwala błękitnego – są spokrewnione z lądowymi ssakami drapieżnymi. Jednak już w latach 70. ubiegłego wieku odkryto skamieniałość wymarłego ssaka Indohyus indirae, którego czaszka zawierała struktury występujące współcześnie jedynie u waleni, natomiast szkielet pozaczaszkowy wskazywał na pokrewieństwo z parzystokopytnymi. Ten ssak prawdopodobnie prowadził wodno-lądowy tryb życia. Badania molekularne potwierdziły, że walenie wywodzą się spośród parzystokopytnych, a ich najbliższymi żyjącymi krewnymi są przedstawiciele monofiletycznej rodziny hipopotamowatych – hipopotamy nilowy i karłowaty. Dalszymi krewnymi są inne parzystokopytne, np. kozica, a jeszcze dalszymi − ssaki nieparzystokopytne, np. koń Przewalskiego.

16.1. (0–1)

Na podstawie tekstu określ pokrewieństwo ewolucyjne między wymienionymi zwierzętami – narysuj brakujące gałęzie drzewa filogenetycznego tak, aby drzewo odzwierciedlało w poprawny sposób to pokrewieństwo.

16.2. (0–1)

Spośród A–D wybierz i zaznacz cechę, która występuje u wszystkich ssaków i wyłącznie u nich.

  1. Włosy obecne przynajmniej w trakcie życia płodowego.
  2. Gruczoły wydzielnicze w skórze właściwej.
  3. Błony płodowe.
  4. Łożysko.

Zadanie 17. (2 pkt)

Ewolucjonizm i historia życia na ziemi Podaj i uzasadnij/wyjaśnij Zamknięte (np. testowe, prawda/fałsz)

Badania genomów współczesnego człowieka rozumnego oraz kopalnego neandertalczyka wykazały, że w populacjach ludzkich występujących poza Afryką jest obecna domieszka DNA neandertalczyka w ilości 3,4–7,3%. W tych populacjach taka domieszka występuje jedynie w DNA jądrowym, natomiast u współcześnie żyjących ludzi nie znaleziono mitochondrialnego DNA pochodzenia neandertalskiego. Może to świadczyć o niepłodności dzieci kobiety neandertalki oraz mężczyzny człowieka rozumnego. Badania wykazały, że genomy człowieka rozumnego oraz neandertalczyka różnią się rearanżacjami (zmianami strukturalnymi) w obrębie niektórych chromosomów, co może zaburzać powstawanie biwalentów, a tym samym – formowanie gamet.

Na podstawie: L.A. Frantz, Neandertal admixture in Eurasia confirmed by maximum-likelihood analysis of three genomes, „Genetics” 196, 2014, s. 1241–1251;
R.L. Rogers, Chromosomal rearrangements as barriers to genetic homogenization between archaic and modern humans, „Molecular Biology and Evolution” 32, 2015, s. 3064–3078.

17.1. (0–1)

Określ, czy człowieka rozumnego oraz neandertalczyka należy uznać za dwa odrębne gatunki biologiczne czy raczej za dwa podgatunki jednego gatunku. Odpowiedź uzasadnij, odwołując się do opisanych zmian genomowych.

17.2. (0–1)

Na podstawie tekstu i własnej wiedzy oceń, czy poniższe informacje są prawdziwe. Zaznacz P, jeśli informacja jest prawdziwa, albo F – jeśli jest fałszywa.

1. W populacjach współczesnego człowieka poza Afryką stwierdzono występowanie mitochondriów pochodzenia neandertalskiego. P F
2. Kobieta neandertalka nie mogła mieć dzieci z mężczyzną Homo sapiens z uwagi na zaburzenie formowania się gamet. P F
3. Do rodzaju Homo zaliczamy tylko jeden współcześnie żyjący gatunek (Homo sapiens) oraz kilka gatunków wymarłych. P F

Zadanie 18. (5 pkt)

Ewolucjonizm i historia życia na ziemi Metody badawcze i doświadczenia Zamknięte (np. testowe, prawda/fałsz) Podaj i uzasadnij/wyjaśnij

Gupiki to niewielkie ryby, które w naturze żyją m.in. na Trynidadzie, w małych zbiornikach wodnych położonych wzdłuż górskich strumieni. Wodospady tworzone przez strumienie pokonujące progi skalne stanowią jednostronną barierę – ryby żyjące w zbiorniku poniżej wodospadu nie mogą przepłynąć w górę potoku, ale ryby ze zbiornika ponad wodospadem niekiedy dostają się ze spadającą wodą do dolnego zbiornika. Samce gupików są mniejsze od samic, ale znacznie bardziej kolorowe. Samica częściej wybiera barwniejszego samca jako partnera do rozmnażania.

Badacze porównywali ubarwienie samców gupików bytujących w dwóch zbiornikach strumienia 1. – w zbiorniku poniżej wodospadu, w którym występowały drapieżniki, oraz w zbiorniku powyżej wodospadu, w którym drapieżników nie było. Zauważyli, że samce gupików ze zbiornika powyżej wodospadu są intensywniej ubarwione od żyjących w zbiorniku poniżej wodospadu. Wyniki obserwacji przedstawia rysunek poniżej.

Badacze wysunęli dwie hipotezy wyjaśniające te różnice.

Hipoteza I: W sytuacji nieobecności drapieżników wyższe dostosowanie mają intensywniej ubarwione samce (ponieważ są częściej wybierane przez samice).
Hipoteza II: W razie presji drapieżników wyższe dostosowanie mają samce mniej widoczne, o mniej intensywnym ubarwieniu (ponieważ są rzadziej zjadane).

Aby sprawdzić te hipotezy, badacze przenosili gupiki i drapieżne ryby ze zbiorników strumienia 1. do odpowiednich zbiorników bezrybnego strumienia 2., a następnie obserwowali zmiany częstości fenotypów samców przez kilkadziesiąt pokoleń. Potwierdzili obie hipotezy: wykazali, że w naturze intensywność ubarwienia samców jest ewolucyjnym kompromisem między przeciwstawnymi kierunkami doboru.

Na podstawie: http://www.guppyevolution.org/science/

18.1. (0–3)

1. Przedstaw plan opisanego eksperymentu – wpisz w tabelę znak „+” oznaczający przeniesienie ryb ze zbiorników strumienia 1. do zbiorników strumienia 2.

Docelowy zbiornik w bezrybnym strumieniu 2. Przenoszone ryby ze strumienia 1.
gupiki z górnego zbiornika (bez drapieżnych ryb) gupiki z dolnego zbiornika (z drapieżnymi rybami) drapieżne ryby z dolnego zbiornika
górny
dolny

2. Podaj populacje gupików (numer strumienia i położenie zbiornika), które porównywano w celu zweryfikowania obu hipotez. Określ spodziewane wyniki, odnosząc się do zmiany fenotypów samców.

Populacje gupików porównywane w celu sprawdzenia hipotezy I:
Wynik potwierdzający hipotezę I:

Populacje gupików porównywane w celu sprawdzenia hipotezy II:
Wynik potwierdzający hipotezę II:

18.2. (0–1)

Określ, czy w opisanym eksperymencie działa dobór naturalny czy dobór sztuczny. Odpowiedź uzasadnij.

18.3. (0–1)

Uzupełnij poniższe zdania tak, aby powstał poprawny opis warunków przeprowadzenia opisanego eksperymentu. W każdym nawiasie podkreśl właściwe określenie.

W celu poprawnego przeprowadzenia opisanego eksperymentu należy przenieść z jednego zbiornika do drugiego (liczną grupę gupików / jedną ich parę). To przy zbyt (niskiej / wysokiej) liczebności grupy założycielskiej nowej populacji nasila się (dryf genetyczny / dobór naturalny), który mógłby zniekształcić wynik doświadczenia.

Zadanie 19. (1 pkt)

Ekologia Podaj i uzasadnij/wyjaśnij

Przykładem rośliny wysokogórskiej jest goryczka krótkołodygowa (Gentiana clusii), przedstawiona na zdjęciu. Ma ona zimozielone, skórzaste, lancetowate i zaostrzone liście, zebrane w rozetę przy samej ziemi. Jej kwiaty wyrastają pojedynczo na szczycie krótkiej łodygi, są intensywnie niebieskie, dzwonkowate i bardzo duże w stosunku do niewielkiego rozmiaru rośliny. Goryczka krótkołodygowa występuje na zboczach skalnych, przeważnie powyżej 1000 m n.p.m.; w Polsce rośnie wyłącznie w Tatrach.

Na podstawie: https://commons.wikimedia.org/wiki/File:Gentiana_clusii_(1).JPG

Wykaż związek budowy zewnętrznej goryczki krótkołodygowej z warunkami jej bytowania. W odpowiedzi uwzględnij jedną z cech budowy tej rośliny, które wymieniono w tekście.

Zadanie 20. (2 pkt)

Ekologia Podaj i uzasadnij/wyjaśnij

Różnorodność biologiczna nie jest jednakowa we wszystkich miejscach na Ziemi. Miejsca wyróżniające się szczególnie dużym bogactwem gatunkowym często nazywane są ogniskami różnorodności biologicznej (z ang. biodiversity hotspots). Na poniższej mapie świata zaznaczono siedem ponumerowanych obszarów.

Na podstawie: http://naszregion-nysa.blogspot.com/2013/09/obiekty-geograficzne-na-mapie-swiata- cz1.html

Spośród obszarów oznaczonych na mapie numerami 1.–7. wypisz numery czterech obszarów, które należą do tzw. ognisk różnorodności biologicznej. Odpowiedź uzasadnij.

Numery obszarów należących do tzw. ognisk różnorodności biologicznej:

Uzasadnienie:

Zadanie 21. (4 pkt)

Wpływ człowieka na środowisko i jego ochrona Ekologia Zamknięte (np. testowe, prawda/fałsz) Podaj i uzasadnij/wyjaśnij Podaj/wymień

Wyspa Świętej Heleny jest położona na Atlantyku ok. 2 tys. km od wybrzeży Afryki i 4 tys. km od Ameryki Południowej. Jej powierzchnia wynosi zaledwie 122 km2, a zatem jest ona mniej więcej wielkości Torunia. Odkryta została w 1502 r. przez Portugalczyków, którzy sprowadzili na nią kozy i trzodę chlewną.

Współcześnie występuje tu ok. 420 gatunków roślin, z których 85% jest obcego pochodzenia. Wśród roślin rodzimych 45 gatunków to endemity. Zagrażają im konkurujące z nimi gatunki obcego pochodzenia, zjadają je także wprowadzone na wyspę zwierzęta roślinożerne, których wcześniej tam nie było.

Kiedyś wyspę pokrywały lasy, w których dominowały endemiczne drzewa: Commidendrum robustum, C. rotundifolium i Trochetiopsis ebenus. Obecnie w naturze zachowały się nieliczne okazy C. robustum oraz jeden okaz C. rotundifolium. Problemem w ratowaniu C. rotundifolium jest jego samopłonność – zaledwie ok. 0,2% zalążków powstałych wskutek samozapylenia jest zdolnych do rozwoju w nasiona zdolne do kiełkowania. Ten gatunek można jednak rozmnażać wegetatywnie. W 1980 roku odkryto pięć drzew T. ebenus – gatunku, który uprzednio uważano za wymarły. Tereny, na których dawniej rosły te endemity, są obecnie pokryte zaroślami składającymi się z gatunków obcych, jak zdziczałe drzewa mangowe i oliwki.

Na podstawie: http://brahmsonline.kew.org/Helena; Autor: Phil Lambdon

21.1. (0–2)

Zaplanuj działania, które należy podjąć w celu restytucji Commidendrum rotundifolium na Wyspie Świętej Heleny. W odpowiedzi uwzględnij przyczyny wymierania oraz biologię tego gatunku.

21.2. (0–1)

Na podstawie tekstu i własnej wiedzy oceń, czy poniższe stwierdzenia są prawdziwe. Zaznacz P, jeśli stwierdzenie jest prawdziwe, albo F – jeśli jest fałszywe.

1. Dużym zagrożeniem dla endemitów Wyspy Świętej Heleny są konkurujące z nimi rośliny obcego pochodzenia. P F
2. Populacje Commidendrum rotundifolium, C. robustum i Trochetiopsis ebenus charakteryzują się bardzo niską różnorodnością genetyczną. P F
3. Endemity Wyspy Świętej Heleny powstały drogą ewolucji dzięki izolacji geograficznej tej wyspy do kontynentu afrykańskiego. P F

21.3. (0–1)

Ratowanie ginących endemicznych gatunków jest często kosztowne, a niekiedy – także mało skuteczne, jeśli ich pierwotne siedliska, zajmujące niewielki obszar, zostały silnie przekształcone przez człowieka, np. zajęte pod uprawy.

Oceń, czy warto ponosić koszty ochrony gatunków, których naturalne środowisko zostało już zniszczone nieodwracalnie. Odpowiedź uzasadnij, odnosząc się do skuteczności lub potrzeby ich ochrony.