Zadania maturalne z biologii

Znalezionych zadań - 116

Strony

1

Biomedica 2022, Poziom rozszerzony (Formuła 2015)Zadanie 3. (2 pkt)

Choroby człowieka Podaj i uzasadnij/wyjaśnij Podaj/wymień

Cholera to zakaźna choroba przewodu pokarmowego, której przyczyną jest spożycie wody lub pokarmu skażonego przecinkowcem cholery. Bakterie uwalniają enterotoksynę, która zwiększając stężenie elektrolitów w świetle jelita powoduje stały wypływ wody z komórek nabłonka jelit do światła przewodu pokarmowego. Objawami tej choroby są: wyniszczająca biegunka, wymioty, stolec przypominający wodę po płukaniu ryżu, szybkie odwodnienie. Zasadnicze znaczenie ma leczenie objawowe polegające na uzupełnianiu utraconych płynów.

3.1. (0–1)

Największa epidemia cholery w Europie panowała w XIX w. Wyjaśnij, dlaczego obecnie nie dochodzi do epidemii cholery w Europie, mimo iż nie stosuje się masowych szczepień ochronnych przeciwko tej chorobie.

3.2. (0–1)

Podaj, w jakiego typu miejscach na świecie może obecnie dochodzić do epidemii cholery.

To zadanie pochodzi ze zbioru matura 2022 wydawnictwa Biomedica
Kup pełny zbiór zadań
2

Biomedica 2022, Poziom rozszerzony (Formuła 2015)Zadanie 17. (2 pkt)

Układ kostny i mięśniowy Choroby człowieka Podaj/wymień

Kręgosłup dzieli się na 5 odcinków: szyjny (7 kręgów), piersiowy (12), lędźwiowy (5), krzyżowy (5 zrośniętych z kością krzyżową), ogonowy (guziczny) (3-5) – zrośniętych w pojedynczą kość ogonową (guziczną). Kształt kręgosłupa oscyluje wokół litery „S”, posiada fizjologiczne krzywizny: odcinek szyjny i lędźwiowy wygięte są do przodu (lordoza), a piersiowy i krzyżowy do tyłu– kifoza.

17.1. (0–1)

Podaj, jakie znaczenia mają fizjologiczne krzywizny kręgosłupa.

17.2. (0–1)

U niektórych osób prowadzących siedzący tryb życia może wystąpić boczne skrzywienie kręgosłupa. Podaj nazwę tego schorzenia.

To zadanie pochodzi ze zbioru matura 2022 wydawnictwa Biomedica
Kup pełny zbiór zadań
3

Biomedica 2022, Poziom rozszerzony (Formuła 2015)Zadanie 21. (3 pkt)

Układ krążenia Choroby człowieka Podaj i uzasadnij/wyjaśnij Podaj/wymień

Ośrodki automatyzmu serca tworzą zmodyfikowane włókna mięśniowe przypominające komórki embrionalne, posiadające zdolność do rytmicznego samopobudzania.

21.1. (0–1)

Podaj nazwę nadrzędnego ośrodka automatyzmu pracy serca.

21.2. (0–1)

W przypadku zatrzymania akcji serca konieczne jest wykonywanie pośredniego masażu serca poprzez rytmiczne uciskanie mostka na głębokość 5-6 centymetrów, w tempie ok. 120 ucisków na minutę. Wyjaśnij, dlaczego konieczne jest, aby rozpocząć masaż jak najszybciej od chwili ustania pracy serca.

21.3. (0–1)

Podaj, jakiego rodzaju leczenie można zastosować (prócz farmakoterapii) przy defektach pracy ośrodków automatyzmu serca.

To zadanie pochodzi ze zbioru matura 2022 wydawnictwa Biomedica
Kup pełny zbiór zadań
4

Informator CKE, Poziom rozszerzony (Formuła 2023)Zadanie 4. (2 pkt)

Prokarionty Choroby człowieka Zamknięte (np. testowe, prawda/fałsz)

Gruźlica jest chorobą zakaźną wywołaną przez bakterie – prątki gruźlicy (Mycobacterium tuberculosis). Najczęściej zakażenie obejmuje płuca, ale prątki gruźlicy mogą docierać do wszystkich narządów i tkanek, a w pewnych okolicznościach – wywołać chorobę, która rozwija się u 5–10% osób zakażonych prątkami.

Szczepionka BCG (Bacillus Calmette-Guérin) zawiera żywe, osłabione prątki bydlęce (Mycobacterium bovis). Szczepionki BCG są uważane za bezpieczne. Odczyny poszczepienne występują bardzo rzadko, a jeżeli występują, to są niebolesne oraz mają tendencję do samowygojenia. Z uwagi na możliwość rozwoju infekcji, szczepionek zawierających żywe bakterie nie należy jednak aplikować osobom o obniżonej odporności, np. przyjmującym leki immunosupresyjne po przeszczepach narządów. Szczepienie BCG chroni niemowlęta i dzieci przed najcięższą postacią gruźlicy, tj. gruźliczym zapaleniem opon mózgowo-rdzeniowych. Jednakże tylko część badań wykazała skuteczność szczepionki BCG w zapobieganiu gruźlicy płuc.

Prątki mają nietypową budowę ściany komórkowej – odmienną zarówno od bakterii Gram- -ujemnych, jak i Gram-dodatnich. Zewnętrzna błona jest stosunkowo gruba i leży na warstwie lipidów złożonych głównie z kwasu mikolowego. Te dwie zewnętrzne warstwy tworzą barierę nieprzepuszczalną dla wielu leków przeciwbakteryjnych, np. dla powszechnie stosowanych antybiotyków β-laktamowych.

Na podstawie: szczepienia.pzh.gov.pl; M. Palmer i inni, Biochemical Pharmacology, University of Waterloo 2012.

4.1. (0–1)

Poniższym schematom (A–C) budowy struktur otaczających komórkę prokariotyczną przyporządkuj odpowiednią grupę bakterii spośród 1.–4.

  1. prątki
  2. bakterie Gram-ujemne
  3. bakterie Gram-dodatnie
  4. bakterie pozbawione ściany komórkowej

4.2. (0–1)

Oceń, czy poniższe informacje dotyczące gruźlicy i jej zapobiegania są prawdziwe. Zaznacz P, jeśli informacja jest prawdziwa, albo F – jeśli jest fałszywa.

1. Zakażenie prątkiem gruźlicy najczęściej przebiega bezobjawowo. P F
2. Szczepionka BCG może być niebezpieczna dla osób z obniżoną odpornością. P F
3. Podstawowym celem podawania szczepionki BCG jest zapobieganie gruźlicy płuc. P F
5

Matura Marzec 2021, Poziom rozszerzony (Formuła 2015)Zadanie 7. (3 pkt)

Choroby człowieka Fizjologia roślin Metody badawcze i doświadczenia Zamknięte (np. testowe, prawda/fałsz) Podaj i uzasadnij/wyjaśnij

Słonecznik bulwiasty – topinambur (Helianthus tuberosus L.) – to roślina pochodząca z Ameryki Północnej uprawiana na różnych kontynentach jako roślina jadalna, pastewna i ozdobna. Poza cienkimi korzeniami wytwarza rozłogi podziemne. Na ich końcach powstają podziemne bulwy, w których magazynowane są asymilaty. Bulwy zawierają inulinę składającą się z około 35 cząsteczek fruktozy. Inulina nie jest trawiona przez ludzi, w związku z czym bulwy mają niewielką wartość odżywczą.

Na wykresie przedstawiono zmiany suchej masy różnych organów topinambura (korzeni, łodyg i liści) podczas jego wzrostu. Krzywe ilustrujące zmiany masy łodyg nadziemnych i bulw oznaczono literami A i B. Pomiary wykonywano w ciągu 33 tygodni, licząc od wysadzenia rośliny aż do momentu zakończenia formowania się nowych bulw.

Na podstawie: J. Kopcewicz, S. Lewak, Fizjologia roślin, Warszawa 2002; L.L.D. Incoll, T.F. Neales, The stem as a temporary sink before tuberization in Helianthus tuberosus, „Journal of Experimental Botany” 21(2),1970.

7.1. (0–1)

Podaj, która z krzywych – A czy B – przedstawia zmiany masy bulw, a która – zmiany masy łodyg nadziemnych. Odpowiedź uzasadnij, uwzględniając funkcje tych struktur.

Zmiany masy bulw:

Zmiany masy łodyg nadziemnych:

Uzasadnienie:

7.2. (0–1)

Uzupełnij poniższe zdania tak, aby zawierały one informacje prawdziwe. Podkreśl w każdym nawiasie właściwe określenie.

Formą transportową produktów asymilacji z liści do bulw topinambura jest (glukoza / sacharoza). W transporcie związków magazynowanych w bulwach topinambura główną rolę odgrywa (floem / ksylem). Inulina będąca głównym związkiem przechowywanym w bulwach jest (dwucukrem / wielocukrem).

7.3. (0–1)

Uzasadnij, że bulwy topinambura mogą być zalecane do zastosowania w diecie osób chorych na cukrzycę.

6

Matura Czerwiec 2021, Poziom rozszerzony (Formuła 2015)Zadanie 8. (3 pkt)

Protisty Choroby człowieka Zamknięte (np. testowe, prawda/fałsz) Podaj i uzasadnij/wyjaśnij Podaj/wymień

Giardioza (lamblioza), wywoływana przez pierwotniaka – giardię jelitową (Giardia lamblia), jest szeroko rozpowszechnioną chorobą pasożytniczą, będącą przyczyną biegunki u ludzi. Cechą charakterystyczną tego pierwotniaka jest obecność podwójnych organellów – dwóch jąder komórkowych i dwóch kompletów wici, ułożonych po obu stronach osi komórki. Do zarażenia się giardią dochodzi drogą pokarmową – przez połknięcie cyst znajdujących się w zanieczyszczonej nimi wodzie lub pokarmie. W jelicie z cyst uwalniają się trofozoity, które przyczepiają się za pomocą specjalnego dysku czepnego, stanowiącego rodzaj przyssawki, do mikrokosmków jelita i intensywnie się rozmnażają. Trofozoity, które nie przyczepią się do komórek nabłonka, są przesuwane dalej wraz z treścią jelita i przekształcają się w cysty, wydalane z kałem żywiciela. Giardioza może mieć charakter przewlekły i nie powodować wyraźnych objawów.

Na schemacie przedstawiono cykl rozwojowy giardii jelitowej w organizmie człowieka.

Na podstawie: A. Wiercińska-Drapało, Giardioza obraz kliniczny, rozpoznawanie i leczenie, „Gastroenterologia kliniczna” 2(3), 2010.

8.1. (0–1)

Uzupełnij poniższe zdania tak, aby zawierały one informacje prawdziwe. Podkreśl w każdym nawiasie właściwe określenie.

Giardia jelitowa jest przedstawicielem (orzęsków / wiciowców). Ten organizm pasożytuje w jelicie (cienkim / grubym) człowieka. Giardia jelitowa rozmnaża się bezpłciowo przez (poprzeczny / podłużny) podział komórki.

8.2. (0–1)

Na podstawie przedstawionych informacji podaj jedną cechę budowy giardii jelitowej stanowiącą przystosowanie do pasożytniczego trybu życia oraz określ, na czym to przystosowanie polega.

8.3. (0–1)

Podaj przykład działania profilaktycznego zapobiegającego giardiozie.

7

Matura Marzec 2021, Poziom rozszerzony (Formuła 2015)Zadanie 9. (2 pkt)

Nicienie Choroby człowieka Zamknięte (np. testowe, prawda/fałsz)

Na schemacie przedstawiono cykl rozwojowy glisty ludzkiej. W Polsce glistnica jest chorobą coraz rzadszą, ale ciągle częstą w krajach tropikalnych, m.in. ze względu na nawożenie upraw ludzkimi odchodami.

http://www.medycynatropikalna.pl

9.1. (0–1)

Na podstawie schematu oceń, czy poniższe stwierdzenia dotyczące glisty ludzkiej są prawdziwe. Zaznacz P, jeśli stwierdzenie jest prawdziwe, albo F – jeśli jest fałszywe.

1. Glista ludzka jest organizmem rozdzielnopłciowym o wyraźnym dymorfizmie płciowym. P F
2. Glista ludzka jest pasożytem jednodomowym, ponieważ ma jednego żywiciela, którym jest człowiek. P F
3. Do rozwoju larw inwazyjnych dochodzi jeszcze zanim jaja opuszczą jelito człowieka. P F

9.2. (0–1)

Z podanych poniżej przykładów ludzkich zachowań wybierz i zaznacz dwa stanowiące czynniki ryzyka zarażenia się glistą ludzką.

  1. Wkładanie do ust różnych przedmiotów przez małe dzieci.
  2. Zjedzenie niemytych surowych warzyw.
  3. Zjedzenie przeterminowanej konserwy mięsnej lub nieświeżej wędliny.
  4. Spożywanie mięsa wieprzowego lub dziczyzny niezbadanych przez weterynarza.
  5. Połknięcie wody podczas pływania w zanieczyszczonym zbiorniku wodnym.
8

Informator CKE, Poziom rozszerzony (Formuła 2023)Zadanie 14. (8 pkt)

Układ immunologiczny Choroby człowieka Ekspresja informacji genetycznej Metody badawcze i doświadczenia Uzupełnij/narysuj wykres, schemat lub tabelę Zamknięte (np. testowe, prawda/fałsz) Podaj i uzasadnij/wyjaśnij

Współcześnie stosuje się dwie podstawowe metody wykrywania zakażeń HIV. Rutynowe badanie polega na wykrywaniu przeciwciał anty-HIV w surowicy pacjenta. W przypadku tej metody czułość badania, czyli prawdopodobieństwo otrzymania wyniku dodatniego u osoby chorej, tzn. wykrycia zakażenia, wynosi 100%, ale wynik dodatni otrzymuje się także dla 0,5% zdrowych osób – specyficzność wynosi 99,5%. Dlatego postawienie diagnozy zakażenia HIV wymaga potwierdzenia dodatkowym badaniem za pomocą metody PCR, wykrywającym gen odwrotnej transkryptazy wbudowany w genom gospodarza. Ta metoda jest teoretycznie bezbłędna pod warunkiem utrzymywania wysokich standardów pracy laboratoryjnej. Odpowiednie próby kontrolne służą sprawdzeniu, czy:

  • polimeraza DNA nie utraciła aktywności podczas przechowywania (kontrola pozytywna),
  • wszystkie odczynniki są wolne od wirusowego materiału genetycznego (kontrola negatywna).

Dla trzech pacjentów uzyskano dodatni wynik testu na obecność przeciwciał anty-HIV. Z tego powodu lekarz zlecił dodatkowe badanie z wykorzystaniem metody PCR, którego wyniki podsumowano w poniższej tabeli.

Próba
badawcza kontrolna pozytywna kontrolna negatywna
Pacjent 1. +
Pacjent 2. + + +
Pacjent 3. + +

Na podstawie: GenBank sekwencja nr KR861191.1; M. Fearon, The Laboratory Diagnosis of HIV Infections, „Can J Dis Med Microbiol” 16, 2005, s. 26–30;
D.S Boyle i inni, Rapid Detection of HIV-1 Proviral DNA for Early Infant Diagnosis Using Recombinase Polymerase Amplification, „mBio” 4, 2013, e00135–13;
S. Koblavi-Dème i inni, Sensitivity and Specificity of Human Immunodeficiency Virus Rapid Serologic Assays and Testing Algorithms in an Antenatal Clinic in Abidjan, Ivory Coast, „J Clin Microbiol” 39, 2001, s. 1808–1812.

14.1. (0–2)

Zaprojektuj doświadczenie PCR wykrywające DNA HIV wbudowane w genom gospodarza. Dla każdej z prób – badawczej, kontrolnej pozytywnej i kontrolnej negatywnej – wybierz wszystkie właściwe składniki mieszaniny reakcyjnej. Wpisz w tabelę znak „+”, jeśli składnik należy dodać do próby, albo znak „–”, jeśli ten składnik należy pominąć.

Próba
badawcza kontrolna pozytywna kontrolna negatywna
DNA genomowy wyizolowany od pacjenta
DNA genomowy wyizolowany z linii komórkowej zakażonej HIV
para specyficznych starterów
bufor zapewniający optymalne pH i stężenie jonów Mg2+
termostabilna polimeraza DNA
mieszanina deoksyrybonukleotydów

14.2. (0–1)

Wybierz spośród A–D i zaznacz prawidłowe sekwencje starterów polF1 i polR1, wykorzystywanych w teście diagnostycznym HIV, przyłączających się do zaznaczonych fragmentów poniższej sekwencji genu odwrotnej transkryptazy wirusa HIV, wbudowanej w genom gospodarza.

  1. polF1 5′ CCCTACAATCCCCAAAGTCAAGGAGTAGTAGAA 3′
    polR1 5′ CTCTGGAAAGGTGAAGGGGCAGTAGTAATACA 3′
  2. polF1 5′ TTCTACTACTCCTTGACTTTGGGGATTGTAGGG 3′
    polR1 5′ TGTATTACTACTGCCCCTTCACCTTTCCAGAG 3′
  3. polF1 5′ CCCTACAATCCCCAAAGTCAAGGAGTAGTAGAA 3′
    polR1 5′ TGTATTACTACTGCCCCTTCACCTTTCCAGAG 3′
  4. polF1 5′ TTCTACTACTCCTTGACTTTGGGGATTGTAGGG 3′
    polR1 5′ CTCTGGAAAGGTGAAGGGGCAGTAGTAATACA 3′

14.3. (0–2)

Podpunkt anulowany przez CKE

Przed zabiegiem chirurgicznym pacjentowi wykonano testy na nosicielstwo wirusa HIV wykrywające przeciwciała anty-HIV. Wynik wyszedł dodatni. Pacjent nie znajduje się w żadnej z grup ryzyka zakażenia HIV. Według oficjalnych danych częstość występowania zakażenia HIV w Polsce wynosi ok. 40 osób na 100 tys.

Oblicz prawdopodobieństwo, że pacjent jest zakażony HIV, z uwzględnieniem czułości i specyficzności testu na przeciwciała anty-HIV. Zapisz obliczenia w wyznaczonych miejscach 1.–3.

  1. Oczekiwana liczba osób zakażonych HIV, u których wynik testu na przeciwciała anty-HIV będzie dodatni, wśród 100 tys. losowo przebadanych osób:
  2. Oczekiwana liczba osób zdrowych (niezakażonych), u których wynik testu na przeciwciała anty-HIV będzie dodatni, wśród 100 tys. losowo przebadanych osób:
  3. Prawdopodobieństwo, że pacjent z dodatnim wynikiem testu na przeciwciała anty-HIV jest zakażony HIV:

14.4. (0–1)

Oceń, czy poniższe interpretacje przedstawionych wyników badań trojga pacjentów są prawidłowe. Zaznacz T (tak), jeśli interpretacja jest prawidłowa, albo N (nie) – jeśli jest nieprawidłowa.

1. U pacjenta 1. wynik testu na przeciwciała anty-HIV był fałszywie dodatni, o czym świadczy wykluczenie zakażenia na podstawie wyników PCR. T N
2. Wyniki testu PCR dla pacjenta 2. są niewiarygodne ze względu na dodatni wynik w próbie kontrolnej negatywnej – należy powtórzyć badanie. T N
3. Dodatkowe badanie techniką PCR potwierdziło podejrzenie, że pacjent 3. jest zakażony HIV. T N

14.5. (0–1)

Wyjaśnij, dlaczego testy wykrywające przeciwciała anty-HIV nie nadają się do diagnostyki zakażeń HIV u noworodków i niemowląt urodzonych przez matki zakażone HIV. W odpowiedzi uwzględnij spodziewany wynik testu oraz funkcjonowanie układu odpornościowego matki.

14.6. (0–1)

Oceń, czy poniższe osoby znajdują się w grupie zwiększonego ryzyka zakażenia HIV. Zaznacz T (tak), jeśli się w niej znajdują, albo N (nie) – jeśli w niej się nie znajdują.

1. Osoby przebywające w jednym pomieszczeniu z osobami zakażonymi HIV, np. w pracy lub szkole. T N
2. Osoby narażone na częste ukąszenia komarów i innych owadów odżywiających się krwią. T N
3. Sąsiedzi osób zakażonych HIV, mieszkający w tym samym domu wielorodzinnym. T N
9

Matura Czerwiec 2021, Poziom rozszerzony (Formuła 2015)Zadanie 14. (2 pkt)

Układ immunologiczny Choroby człowieka Podaj i uzasadnij/wyjaśnij

Wirusowe zapalenie wątroby typu C (WZW C) jest wywoływane zakażeniem przez wirus zapalenia wątroby typu C (HCV). Źródłem zakażenia jest krew. Warunkiem przeniesienia zakażenia na inną osobę jest naruszenie ciągłości tkanek (przekłucie lub uszkodzenie skóry lub błony śluzowej), przez które wirus może dostać się do krwi. Jedną z zasad profilaktyki zakażenia HCV jest używanie rękawiczek ochronnych przez personel medyczny, kosmetyczki, czy inne osoby, które w związku z wykonywaną pracą mogą mieć kontakt z krwią innych ludzi. Aby zdiagnozować zakażenie HCV, w pierwszej kolejności wykonuje się badanie krwi pacjenta, mające na celu wykrycie przeciwciał anty-HCV. Jednak nie zawsze obecność przeciwciał anty-HCV we krwi świadczy o aktywnym zakażeniu wirusem HCV. Z tego powodu po wykryciu przeciwciał anty-HCV wykonuje się kolejne badanie, czyli test na obecność materiału genetycznego tego wirusa (RNA HCV). Dodatni wynik tego testu oznacza, że we krwi wykazana została obecność materiału genetycznego HCV, co świadczy o aktywnym zakażeniu, a u pacjenta może rozwinąć się zapalenie wątroby.

Wiele osób zakażonych HCV przez długi czas nie ma objawów choroby i czuje się dobrze. Niestety do tej pory nie ma dostępnej skutecznej szczepionki przeciw HCV.

Na podstawie: http://www.hcv.pzh.gov.pl

14.1. (0–1)

Wyjaśnij, dlaczego obecność przeciwciał anty-HCV we krwi badanej osoby nie zawsze świadczy o obecności tego wirusa w organizmie tej osoby.

14.2. (0–1)

Uzasadnij, że w celu zapobiegania zakażeniu HCV nie wystarczy, aby osoba pobierająca krew pracowała w rękawiczkach ochronnych, ale powinna zmieniać te rękawiczki po każdym pacjencie.

10

Strony