Zadania maturalne z biologii

Znalezionych zadań - 113

Strony

1

Biomedica 2022, Poziom rozszerzony (Formuła 2015)Zadanie 3. (2 pkt)

Choroby człowieka Podaj i uzasadnij/wyjaśnij Podaj/wymień

Cholera to zakaźna choroba przewodu pokarmowego, której przyczyną jest spożycie wody lub pokarmu skażonego przecinkowcem cholery. Bakterie uwalniają enterotoksynę, która zwiększając stężenie elektrolitów w świetle jelita powoduje stały wypływ wody z komórek nabłonka jelit do światła przewodu pokarmowego. Objawami tej choroby są: wyniszczająca biegunka, wymioty, stolec przypominający wodę po płukaniu ryżu, szybkie odwodnienie. Zasadnicze znaczenie ma leczenie objawowe polegające na uzupełnianiu utraconych płynów.

3.1. (0–1)

Największa epidemia cholery w Europie panowała w XIX w. Wyjaśnij, dlaczego obecnie nie dochodzi do epidemii cholery w Europie, mimo iż nie stosuje się masowych szczepień ochronnych przeciwko tej chorobie.

3.2. (0–1)

Podaj, w jakiego typu miejscach na świecie może obecnie dochodzić do epidemii cholery.

To zadanie pochodzi ze zbioru matura 2022 wydawnictwa Biomedica
Kup pełny zbiór zadań
2

Biomedica 2022, Poziom rozszerzony (Formuła 2015)Zadanie 17. (2 pkt)

Układ kostny i mięśniowy Choroby człowieka Podaj/wymień

Kręgosłup dzieli się na 5 odcinków: szyjny (7 kręgów), piersiowy (12), lędźwiowy (5), krzyżowy (5 zrośniętych z kością krzyżową), ogonowy (guziczny) (3-5) – zrośniętych w pojedynczą kość ogonową (guziczną). Kształt kręgosłupa oscyluje wokół litery „S”, posiada fizjologiczne krzywizny: odcinek szyjny i lędźwiowy wygięte są do przodu (lordoza), a piersiowy i krzyżowy do tyłu– kifoza.

17.1. (0–1)

Podaj, jakie znaczenia mają fizjologiczne krzywizny kręgosłupa.

17.2. (0–1)

U niektórych osób prowadzących siedzący tryb życia może wystąpić boczne skrzywienie kręgosłupa. Podaj nazwę tego schorzenia.

To zadanie pochodzi ze zbioru matura 2022 wydawnictwa Biomedica
Kup pełny zbiór zadań
3

Biomedica 2022, Poziom rozszerzony (Formuła 2015)Zadanie 21. (3 pkt)

Układ krążenia Choroby człowieka Podaj i uzasadnij/wyjaśnij Podaj/wymień

Ośrodki automatyzmu serca tworzą zmodyfikowane włókna mięśniowe przypominające komórki embrionalne, posiadające zdolność do rytmicznego samopobudzania.

21.1. (0–1)

Podaj nazwę nadrzędnego ośrodka automatyzmu pracy serca.

21.2. (0–1)

W przypadku zatrzymania akcji serca konieczne jest wykonywanie pośredniego masażu serca poprzez rytmiczne uciskanie mostka na głębokość 5-6 centymetrów, w tempie ok. 120 ucisków na minutę. Wyjaśnij, dlaczego konieczne jest, aby rozpocząć masaż jak najszybciej od chwili ustania pracy serca.

21.3. (0–1)

Podaj, jakiego rodzaju leczenie można zastosować (prócz farmakoterapii) przy defektach pracy ośrodków automatyzmu serca.

To zadanie pochodzi ze zbioru matura 2022 wydawnictwa Biomedica
Kup pełny zbiór zadań
4

Informator CKE, Poziom rozszerzony (Formuła 2023)Zadanie 4. (2 pkt)

Prokarionty Choroby człowieka Zamknięte (np. testowe, prawda/fałsz)

Gruźlica jest chorobą zakaźną wywołaną przez bakterie – prątki gruźlicy (Mycobacterium tuberculosis). Najczęściej zakażenie obejmuje płuca, ale prątki gruźlicy mogą docierać do wszystkich narządów i tkanek, a w pewnych okolicznościach – wywołać chorobę, która rozwija się u 5–10% osób zakażonych prątkami.

Szczepionka BCG (Bacillus Calmette-Guérin) zawiera żywe, osłabione prątki bydlęce (Mycobacterium bovis). Szczepionki BCG są uważane za bezpieczne. Odczyny poszczepienne występują bardzo rzadko, a jeżeli występują, to są niebolesne oraz mają tendencję do samowygojenia. Z uwagi na możliwość rozwoju infekcji, szczepionek zawierających żywe bakterie nie należy jednak aplikować osobom o obniżonej odporności, np. przyjmującym leki immunosupresyjne po przeszczepach narządów. Szczepienie BCG chroni niemowlęta i dzieci przed najcięższą postacią gruźlicy, tj. gruźliczym zapaleniem opon mózgowo-rdzeniowych. Jednakże tylko część badań wykazała skuteczność szczepionki BCG w zapobieganiu gruźlicy płuc.

Prątki mają nietypową budowę ściany komórkowej – odmienną zarówno od bakterii Gram- -ujemnych, jak i Gram-dodatnich. Zewnętrzna błona jest stosunkowo gruba i leży na warstwie lipidów złożonych głównie z kwasu mikolowego. Te dwie zewnętrzne warstwy tworzą barierę nieprzepuszczalną dla wielu leków przeciwbakteryjnych, np. dla powszechnie stosowanych antybiotyków β-laktamowych.

Na podstawie: szczepienia.pzh.gov.pl; M. Palmer i inni, Biochemical Pharmacology, University of Waterloo 2012.

4.1. (0–1)

Poniższym schematom (A–C) budowy struktur otaczających komórkę prokariotyczną przyporządkuj odpowiednią grupę bakterii spośród 1.–4.

  1. prątki
  2. bakterie Gram-ujemne
  3. bakterie Gram-dodatnie
  4. bakterie pozbawione ściany komórkowej

4.2. (0–1)

Oceń, czy poniższe informacje dotyczące gruźlicy i jej zapobiegania są prawdziwe. Zaznacz P, jeśli informacja jest prawdziwa, albo F – jeśli jest fałszywa.

1. Zakażenie prątkiem gruźlicy najczęściej przebiega bezobjawowo. P F
2. Szczepionka BCG może być niebezpieczna dla osób z obniżoną odpornością. P F
3. Podstawowym celem podawania szczepionki BCG jest zapobieganie gruźlicy płuc. P F
5

Matura Marzec 2021, Poziom rozszerzony (Formuła 2015)Zadanie 7. (3 pkt)

Choroby człowieka Fizjologia roślin Metody badawcze i doświadczenia Zamknięte (np. testowe, prawda/fałsz) Podaj i uzasadnij/wyjaśnij

Słonecznik bulwiasty – topinambur (Helianthus tuberosus L.) – to roślina pochodząca z Ameryki Północnej uprawiana na różnych kontynentach jako roślina jadalna, pastewna i ozdobna. Poza cienkimi korzeniami wytwarza rozłogi podziemne. Na ich końcach powstają podziemne bulwy, w których magazynowane są asymilaty. Bulwy zawierają inulinę składającą się z około 35 cząsteczek fruktozy. Inulina nie jest trawiona przez ludzi, w związku z czym bulwy mają niewielką wartość odżywczą.

Na wykresie przedstawiono zmiany suchej masy różnych organów topinambura (korzeni, łodyg i liści) podczas jego wzrostu. Krzywe ilustrujące zmiany masy łodyg nadziemnych i bulw oznaczono literami A i B. Pomiary wykonywano w ciągu 33 tygodni, licząc od wysadzenia rośliny aż do momentu zakończenia formowania się nowych bulw.

Na podstawie: J. Kopcewicz, S. Lewak, Fizjologia roślin, Warszawa 2002; L.L.D. Incoll, T.F. Neales, The stem as a temporary sink before tuberization in Helianthus tuberosus, „Journal of Experimental Botany” 21(2),1970.

7.1. (0–1)

Podaj, która z krzywych – A czy B – przedstawia zmiany masy bulw, a która – zmiany masy łodyg nadziemnych. Odpowiedź uzasadnij, uwzględniając funkcje tych struktur.

Zmiany masy bulw:

Zmiany masy łodyg nadziemnych:

Uzasadnienie:

7.2. (0–1)

Uzupełnij poniższe zdania tak, aby zawierały one informacje prawdziwe. Podkreśl w każdym nawiasie właściwe określenie.

Formą transportową produktów asymilacji z liści do bulw topinambura jest (glukoza / sacharoza). W transporcie związków magazynowanych w bulwach topinambura główną rolę odgrywa (floem / ksylem). Inulina będąca głównym związkiem przechowywanym w bulwach jest (dwucukrem / wielocukrem).

7.3. (0–1)

Uzasadnij, że bulwy topinambura mogą być zalecane do zastosowania w diecie osób chorych na cukrzycę.

6

Matura Marzec 2021, Poziom rozszerzony (Formuła 2015)Zadanie 9. (2 pkt)

Nicienie Choroby człowieka Zamknięte (np. testowe, prawda/fałsz)

Na schemacie przedstawiono cykl rozwojowy glisty ludzkiej. W Polsce glistnica jest chorobą coraz rzadszą, ale ciągle częstą w krajach tropikalnych, m.in. ze względu na nawożenie upraw ludzkimi odchodami.

http://www.medycynatropikalna.pl

9.1. (0–1)

Na podstawie schematu oceń, czy poniższe stwierdzenia dotyczące glisty ludzkiej są prawdziwe. Zaznacz P, jeśli stwierdzenie jest prawdziwe, albo F – jeśli jest fałszywe.

1. Glista ludzka jest organizmem rozdzielnopłciowym o wyraźnym dymorfizmie płciowym. P F
2. Glista ludzka jest pasożytem jednodomowym, ponieważ ma jednego żywiciela, którym jest człowiek. P F
3. Do rozwoju larw inwazyjnych dochodzi jeszcze zanim jaja opuszczą jelito człowieka. P F

9.2. (0–1)

Z podanych poniżej przykładów ludzkich zachowań wybierz i zaznacz dwa stanowiące czynniki ryzyka zarażenia się glistą ludzką.

  1. Wkładanie do ust różnych przedmiotów przez małe dzieci.
  2. Zjedzenie niemytych surowych warzyw.
  3. Zjedzenie przeterminowanej konserwy mięsnej lub nieświeżej wędliny.
  4. Spożywanie mięsa wieprzowego lub dziczyzny niezbadanych przez weterynarza.
  5. Połknięcie wody podczas pływania w zanieczyszczonym zbiorniku wodnym.
7

Informator CKE, Poziom rozszerzony (Formuła 2023)Zadanie 14. (8 pkt)

Metody badawcze i doświadczenia Ekspresja informacji genetycznej Choroby człowieka Układ immunologiczny Uzupełnij/narysuj wykres, schemat lub tabelę Zamknięte (np. testowe, prawda/fałsz) Podaj i uzasadnij/wyjaśnij

Współcześnie stosuje się dwie podstawowe metody wykrywania zakażeń HIV. Rutynowe badanie polega na wykrywaniu przeciwciał anty-HIV w surowicy pacjenta. W przypadku tej metody czułość badania, czyli prawdopodobieństwo otrzymania wyniku dodatniego u osoby chorej, tzn. wykrycia zakażenia, wynosi 100%, ale wynik dodatni otrzymuje się także dla 0,5% zdrowych osób – specyficzność wynosi 99,5%. Dlatego postawienie diagnozy zakażenia HIV wymaga potwierdzenia dodatkowym badaniem za pomocą metody PCR, wykrywającym gen odwrotnej transkryptazy wbudowany w genom gospodarza. Ta metoda jest teoretycznie bezbłędna pod warunkiem utrzymywania wysokich standardów pracy laboratoryjnej. Odpowiednie próby kontrolne służą sprawdzeniu, czy:

  • polimeraza DNA nie utraciła aktywności podczas przechowywania (kontrola pozytywna),
  • wszystkie odczynniki są wolne od wirusowego materiału genetycznego (kontrola negatywna).

Dla trzech pacjentów uzyskano dodatni wynik testu na obecność przeciwciał anty-HIV. Z tego powodu lekarz zlecił dodatkowe badanie z wykorzystaniem metody PCR, którego wyniki podsumowano w poniższej tabeli.

Próba
badawcza kontrolna pozytywna kontrolna negatywna
Pacjent 1. +
Pacjent 2. + + +
Pacjent 3. + +

Na podstawie: GenBank sekwencja nr KR861191.1; M. Fearon, The Laboratory Diagnosis of HIV Infections, „Can J Dis Med Microbiol” 16, 2005, s. 26–30;
D.S Boyle i inni, Rapid Detection of HIV-1 Proviral DNA for Early Infant Diagnosis Using Recombinase Polymerase Amplification, „mBio” 4, 2013, e00135–13;
S. Koblavi-Dème i inni, Sensitivity and Specificity of Human Immunodeficiency Virus Rapid Serologic Assays and Testing Algorithms in an Antenatal Clinic in Abidjan, Ivory Coast, „J Clin Microbiol” 39, 2001, s. 1808–1812.

14.1. (0–2)

Zaprojektuj doświadczenie PCR wykrywające DNA HIV wbudowane w genom gospodarza. Dla każdej z prób – badawczej, kontrolnej pozytywnej i kontrolnej negatywnej – wybierz wszystkie właściwe składniki mieszaniny reakcyjnej. Wpisz w tabelę znak „+”, jeśli składnik należy dodać do próby, albo znak „–”, jeśli ten składnik należy pominąć.

Próba
badawcza kontrolna pozytywna kontrolna negatywna
DNA genomowy wyizolowany od pacjenta
DNA genomowy wyizolowany z linii komórkowej zakażonej HIV
para specyficznych starterów
bufor zapewniający optymalne pH i stężenie jonów Mg2+
termostabilna polimeraza DNA
mieszanina deoksyrybonukleotydów

14.2. (0–1)

Wybierz spośród A–D i zaznacz prawidłowe sekwencje starterów polF1 i polR1, wykorzystywanych w teście diagnostycznym HIV, przyłączających się do zaznaczonych fragmentów poniższej sekwencji genu odwrotnej transkryptazy wirusa HIV, wbudowanej w genom gospodarza.

  1. polF1 5′ CCCTACAATCCCCAAAGTCAAGGAGTAGTAGAA 3′
    polR1 5′ CTCTGGAAAGGTGAAGGGGCAGTAGTAATACA 3′
  2. polF1 5′ TTCTACTACTCCTTGACTTTGGGGATTGTAGGG 3′
    polR1 5′ TGTATTACTACTGCCCCTTCACCTTTCCAGAG 3′
  3. polF1 5′ CCCTACAATCCCCAAAGTCAAGGAGTAGTAGAA 3′
    polR1 5′ TGTATTACTACTGCCCCTTCACCTTTCCAGAG 3′
  4. polF1 5′ TTCTACTACTCCTTGACTTTGGGGATTGTAGGG 3′
    polR1 5′ CTCTGGAAAGGTGAAGGGGCAGTAGTAATACA 3′

14.3. (0–2)

Przed zabiegiem chirurgicznym pacjentowi wykonano testy na nosicielstwo wirusa HIV wykrywające przeciwciała anty-HIV. Wynik wyszedł dodatni. Pacjent nie znajduje się w żadnej z grup ryzyka zakażenia HIV. Według oficjalnych danych częstość występowania zakażenia HIV w Polsce wynosi ok. 40 osób na 100 tys.

Oblicz prawdopodobieństwo, że pacjent jest zakażony HIV, z uwzględnieniem czułości i specyficzności testu na przeciwciała anty-HIV. Zapisz obliczenia w wyznaczonych miejscach 1.–3.

  1. Oczekiwana liczba osób zakażonych HIV, u których wynik testu na przeciwciała anty-HIV będzie dodatni, wśród 100 tys. losowo przebadanych osób:
  2. Oczekiwana liczba osób zdrowych (niezakażonych), u których wynik testu na przeciwciała anty-HIV będzie dodatni, wśród 100 tys. losowo przebadanych osób:
  3. Prawdopodobieństwo, że pacjent z dodatnim wynikiem testu na przeciwciała anty-HIV jest zakażony HIV:

14.4. (0–1)

Oceń, czy poniższe interpretacje przedstawionych wyników badań trojga pacjentów są prawidłowe. Zaznacz T (tak), jeśli interpretacja jest prawidłowa, albo N (nie) – jeśli jest nieprawidłowa.

1. U pacjenta 1. wynik testu na przeciwciała anty-HIV był fałszywie dodatni, o czym świadczy wykluczenie zakażenia na podstawie wyników PCR. T N
2. Wyniki testu PCR dla pacjenta 2. są niewiarygodne ze względu na dodatni wynik w próbie kontrolnej negatywnej – należy powtórzyć badanie. T N
3. Dodatkowe badanie techniką PCR potwierdziło podejrzenie, że pacjent 3. jest zakażony HIV. T N

14.5. (0–1)

Wyjaśnij, dlaczego testy wykrywające przeciwciała anty-HIV nie nadają się do diagnostyki zakażeń HIV u noworodków i niemowląt urodzonych przez matki zakażone HIV. W odpowiedzi uwzględnij spodziewany wynik testu oraz funkcjonowanie układu odpornościowego matki.

14.6. (0–1)

Oceń, czy poniższe osoby znajdują się w grupie zwiększonego ryzyka zakażenia HIV. Zaznacz T (tak), jeśli się w niej znajdują, albo N (nie) – jeśli w niej się nie znajdują.

1. Osoby przebywające w jednym pomieszczeniu z osobami zakażonymi HIV, np. w pracy lub szkole. T N
2. Osoby narażone na częste ukąszenia komarów i innych owadów odżywiających się krwią. T N
3. Sąsiedzi osób zakażonych HIV, mieszkający w tym samym domu wielorodzinnym. T N
8

Matura Maj 2021, Poziom rozszerzony (Formuła 2015)Zadanie 17. (3 pkt)

Choroby człowieka Dziedziczenie Zamknięte (np. testowe, prawda/fałsz) Podaj i uzasadnij/wyjaśnij Podaj/wymień

Przyczyną wrodzonej nietolerancji fruktozy są mutacje w genie ALDOB, kodującym enzym aldolazę B i zlokalizowanym na chromosomie 9. Jeżeli uszkodzona jest tylko jedna kopia genu, oznacza to nosicielstwo tej choroby, co w większości przypadków nie wywołuje żadnych objawów. Częstość występowania wrodzonej nietolerancji fruktozy u człowieka wynosi 1/40 000. Objawy choroby ujawniają się zwykle w okresie niemowlęcym po zakończeniu karmienia dziecka wyłącznie mlekiem matki, kiedy do diety dziecka wprowadzane są pierwsze owoce i warzywa. Wrodzona nietolerancja fruktozy prowadzi, po spożyciu tego cukru, do gromadzenia się jego metabolitów w komórkach wątroby: brak aldolazy B powoduje nagromadzenie fruktozo-1-fosforanu, co z kolei prowadzi do upośledzenia glukoneogenezy oraz ograniczenia syntezy ATP. U osób chorych należy wykluczyć z diety owoce, niektóre warzywa, miód oraz cukier spożywczy (sacharozę).

Na podstawie: https://biotechnologia.pl/;
L. Szablewski, A. Skopińska, Zaburzenia metabolizmu węglowodanów powodowane mutacjami i rola diety jako terapii. Część II. Fruktozemia, „Medycyna Rodzinna” 4, 2005.

17.1. (0–1)

Dokończ zdanie. Zaznacz właściwą odpowiedź spośród podanych.

Wrodzona nietolerancja fruktozy jest dziedziczona w sposób

  1. autosomalny recesywny.
  2. autosomalny dominujący.
  3. sprzężony z płcią recesywny.
  4. sprzężony z płcią dominujący.

17.2. (0–1)

Oblicz częstość występowania nosicieli wrodzonej nietolerancji fruktozy w populacji pozostającej w stanie równowagi genetycznej, w której częstość występowania wrodzonej nietolerancji fruktozy wynosi 1/40 000.

Obliczenia:

 

 

Częstość występowania nosicieli wrodzonej nietolerancji fruktozy wynosi:

17.3. (0–1)

Uzasadnij, że osoba cierpiąca na wrodzoną nietolerancję fruktozy powinna wyeliminować z diety sacharozę.

9
10

Matura Maj 2021, Poziom rozszerzony (Formuła 2015)Zadanie 19. (5 pkt)

Układ krążenia Choroby człowieka Dziedziczenie Ekspresja informacji genetycznej Zamknięte (np. testowe, prawda/fałsz) Podaj i uzasadnij/wyjaśnij Podaj/wymień

W strukturze genu obok fragmentów kodujących (eksonów) mogą występować elementy niekodujące, takie jak promotor lub introny.

W poniższej tabeli przedstawiono informacje na temat sześciu wybranych genów człowieka, oznaczonych numerami 1.–6., kodujących określone białka.

Oznaczenie genu Kodowane białko Oznaczenie chromosomu Wielkość genu (kpz DNA) Wielkość mRNA (kz)
1. α-globina 16 0,8 0,5
2. albumina 4 25,0 2,1
3. receptor LDL 19 45,0 5,5
4. kinaza zależna od cyklin 4 54,0 1,7
5. hydroksylaza fenyloalaninowa 12 90,0 2,4
6. dystrofina X 2000,0 16,0

kpz – tysiąc par zasad
kz – tysiąc zasad

Na podstawie: red. J. Bal, Biologia molekularna w medycynie, Warszawa 2013;
https://ghr.nlm.nih.gov/gene;
https://www.ncbi.nlm.nih.gov.

19.1. (0–1)

Podaj nazwę procesu, którego produktem jest pre-mRNA, oraz określ lokalizację tego procesu w komórce człowieka.

Nazwa procesu:
Lokalizacja procesu:

19.2. (0–1)

Wyjaśnij, z czego wynikają różnice między wielkościami genów a wielkościami cząsteczek mRNA, które im odpowiadają.

19.3. (0–1)

Podaj nazwę choroby, u podłoża której leży mutacja genu kodującego hydroksylazę fenyloalaninową, prowadząca do utraty funkcji tego enzymu niezbędnego w metabolizmie fenyloalaniny.

19.4. (0–1)

Spośród wymienionych w tabeli wybierz i zapisz oznaczenia pary genów, które mogą dziedziczyć się niezgodnie z II prawem Mendla. Odpowiedź uzasadnij, odwołując się do treści tego prawa oraz do lokalizacji wybranych genów w genomie.

19.5. (0–1)

Uzupełnij poniższe zdania tak, aby powstał poprawny opis dotyczący albumin. Podkreśl w każdym nawiasie właściwe określenie.

Albuminy to białka (rozpuszczalne / nierozpuszczalne) w wodzie, występujące głównie (w cytoplazmie erytrocytów / w osoczu krwi). Główną funkcją tych białek jest (transport tlenu / regulacja ciśnienia osmotycznego krwi).

Strony