Zadania maturalne z biologii

Znalezionych zadań - 178

Strony

1

Informator CKE, Poziom rozszerzony (Formuła 2023)Zadanie 5. (3 pkt)

Grzyby Oddychanie komórkowe Uzupełnij/narysuj wykres, schemat lub tabelę Podaj i uzasadnij/wyjaśnij

W celu wykazania, że intensywność fermentacji alkoholowej przeprowadzanej przez drożdże piekarnicze zależy od warunków środowiskowych, uczniowie przygotowali trzy różne zestawy doświadczalne (A–C), przedstawione na rysunku poniżej. W skład każdego z nich wchodziła kolba wypełniona zawiesiną drożdży w wodnym roztworze cukru (glukozy), ale inny był sposób zamknięcia naczynia lub kolba pozostała otwarta. Wszystkie trzy zestawy były regularnie wytrząsane i utrzymywane w temperaturze 30°C – optymalnej dla wzrostu drożdży.

5.1. (0–2)

Określ, w którym zestawie (A–C) fermentacja alkoholowa zachodziła z najmniejszą intensywnością, a w którym – z największą. Odpowiedź uzasadnij, odwołując się do warunków panujących w każdym z zestawów.

Fermentacja zachodziła z:

  1. najmniejszą intensywnością w zestawie , ponieważ
  2. największą intensywnością w zestawie , ponieważ

5.2. (0–1)

Uzupełnij poniższy schemat reakcji fermentacji alkoholowej – wybierz właściwe związki chemiczne spośród wymienionych poniżej i wpisz je w odpowiednie miejsca.

2 pirogronian
2 dwutlenek węgla
2 NADH + 2H+
2 ATP
2

Informator CKE, Poziom rozszerzony (Formuła 2023)Zadanie 10. (3 pkt)

Układ kostny i mięśniowy Układ oddechowy Podaj i uzasadnij/wyjaśnij Zamknięte (np. testowe, prawda/fałsz) Uzupełnij/narysuj wykres, schemat lub tabelę

Mioglobina jest białkiem występującym w mięśniach kręgowców. U ssaków nurkujących służy jako magazyn tlenu: pozwala na pracę mięśni w warunkach chwilowego niedotlenienia całego organizmu. Natomiast obecność mioglobiny w mięśniach pozostałych ssaków przede wszystkim wpływa na efektywność dyfuzji tlenu z krwi do mięśni.

Na poniższym wykresie przedstawiono powinowactwo mioglobiny do tlenu oraz powinowactwo hemoglobiny do tlenu w pięciu różnych pH.

Na podstawie: R.G. Garrett, C.M. Grisham, Biochemistry, University of Virginia 2010, s. 474; J.M. Berg, J.L. Tymoczko, L. Stryer, Biochemia, Warszawa 2009, s. 183–193.

10.1. (0–1)

Określ, jaki wpływ na dyfuzję tlenu z krwi do włókien mięśniowych ma mioglobina występująca w cytozolu tych komórek. Odpowiedź uzasadnij, odnosząc się do danych przedstawionych na wykresie.

10.2. (0–1)

Uzupełnij poniższe zdanie tak, aby w poprawny sposób opisywało ono procesy wymiany gazowej zachodzące w płucach człowieka. W każdym nawiasie podkreśl właściwe określenie.

Podczas wymiany gazowej w płucach człowieka dyfuzja CO2 z krwi do pęcherzyków płucnych jest przyczyną (wzrostu / spadku) pH krwi, a dzięki temu następuje (wzrost / spadek) powinowactwa hemoglobiny do tlenu.

10.3. (0–1)

Uzupełnij poniższy schemat tak, aby poprawnie ilustrował drogę tlenu z powietrza pęcherzykowego, aż do jego wykorzystania w procesie tlenowego oddychania wewnątrzkomórkowego. Wpisz we właściwe miejsca wymienione poniżej nazwy.

oksymioglobina
oksyhemoglobina
mitochondrium

tlen cząsteczkowy →

3

Informator CKE, Poziom rozszerzony (Formuła 2023)Zadanie 14. (8 pkt)

Metody badawcze i doświadczenia Ekspresja informacji genetycznej Choroby człowieka Układ immunologiczny Uzupełnij/narysuj wykres, schemat lub tabelę Zamknięte (np. testowe, prawda/fałsz) Podaj i uzasadnij/wyjaśnij

Współcześnie stosuje się dwie podstawowe metody wykrywania zakażeń HIV. Rutynowe badanie polega na wykrywaniu przeciwciał anty-HIV w surowicy pacjenta. W przypadku tej metody czułość badania, czyli prawdopodobieństwo otrzymania wyniku dodatniego u osoby chorej, tzn. wykrycia zakażenia, wynosi 100%, ale wynik dodatni otrzymuje się także dla 0,5% zdrowych osób – specyficzność wynosi 99,5%. Dlatego postawienie diagnozy zakażenia HIV wymaga potwierdzenia dodatkowym badaniem za pomocą metody PCR, wykrywającym gen odwrotnej transkryptazy wbudowany w genom gospodarza. Ta metoda jest teoretycznie bezbłędna pod warunkiem utrzymywania wysokich standardów pracy laboratoryjnej. Odpowiednie próby kontrolne służą sprawdzeniu, czy:

  • polimeraza DNA nie utraciła aktywności podczas przechowywania (kontrola pozytywna),
  • wszystkie odczynniki są wolne od wirusowego materiału genetycznego (kontrola negatywna).

Dla trzech pacjentów uzyskano dodatni wynik testu na obecność przeciwciał anty-HIV. Z tego powodu lekarz zlecił dodatkowe badanie z wykorzystaniem metody PCR, którego wyniki podsumowano w poniższej tabeli.

Próba
badawcza kontrolna pozytywna kontrolna negatywna
Pacjent 1. +
Pacjent 2. + + +
Pacjent 3. + +

Na podstawie: GenBank sekwencja nr KR861191.1; M. Fearon, The Laboratory Diagnosis of HIV Infections, „Can J Dis Med Microbiol” 16, 2005, s. 26–30;
D.S Boyle i inni, Rapid Detection of HIV-1 Proviral DNA for Early Infant Diagnosis Using Recombinase Polymerase Amplification, „mBio” 4, 2013, e00135–13;
S. Koblavi-Dème i inni, Sensitivity and Specificity of Human Immunodeficiency Virus Rapid Serologic Assays and Testing Algorithms in an Antenatal Clinic in Abidjan, Ivory Coast, „J Clin Microbiol” 39, 2001, s. 1808–1812.

14.1. (0–2)

Zaprojektuj doświadczenie PCR wykrywające DNA HIV wbudowane w genom gospodarza. Dla każdej z prób – badawczej, kontrolnej pozytywnej i kontrolnej negatywnej – wybierz wszystkie właściwe składniki mieszaniny reakcyjnej. Wpisz w tabelę znak „+”, jeśli składnik należy dodać do próby, albo znak „–”, jeśli ten składnik należy pominąć.

Próba
badawcza kontrolna pozytywna kontrolna negatywna
DNA genomowy wyizolowany od pacjenta
DNA genomowy wyizolowany z linii komórkowej zakażonej HIV
para specyficznych starterów
bufor zapewniający optymalne pH i stężenie jonów Mg2+
termostabilna polimeraza DNA
mieszanina deoksyrybonukleotydów

14.2. (0–1)

Wybierz spośród A–D i zaznacz prawidłowe sekwencje starterów polF1 i polR1, wykorzystywanych w teście diagnostycznym HIV, przyłączających się do zaznaczonych fragmentów poniższej sekwencji genu odwrotnej transkryptazy wirusa HIV, wbudowanej w genom gospodarza.

  1. polF1 5′ CCCTACAATCCCCAAAGTCAAGGAGTAGTAGAA 3′
    polR1 5′ CTCTGGAAAGGTGAAGGGGCAGTAGTAATACA 3′
  2. polF1 5′ TTCTACTACTCCTTGACTTTGGGGATTGTAGGG 3′
    polR1 5′ TGTATTACTACTGCCCCTTCACCTTTCCAGAG 3′
  3. polF1 5′ CCCTACAATCCCCAAAGTCAAGGAGTAGTAGAA 3′
    polR1 5′ TGTATTACTACTGCCCCTTCACCTTTCCAGAG 3′
  4. polF1 5′ TTCTACTACTCCTTGACTTTGGGGATTGTAGGG 3′
    polR1 5′ CTCTGGAAAGGTGAAGGGGCAGTAGTAATACA 3′

14.3. (0–2)

Przed zabiegiem chirurgicznym pacjentowi wykonano testy na nosicielstwo wirusa HIV wykrywające przeciwciała anty-HIV. Wynik wyszedł dodatni. Pacjent nie znajduje się w żadnej z grup ryzyka zakażenia HIV. Według oficjalnych danych częstość występowania zakażenia HIV w Polsce wynosi ok. 40 osób na 100 tys.

Oblicz prawdopodobieństwo, że pacjent jest zakażony HIV, z uwzględnieniem czułości i specyficzności testu na przeciwciała anty-HIV. Zapisz obliczenia w wyznaczonych miejscach 1.–3.

  1. Oczekiwana liczba osób zakażonych HIV, u których wynik testu na przeciwciała anty-HIV będzie dodatni, wśród 100 tys. losowo przebadanych osób:
  2. Oczekiwana liczba osób zdrowych (niezakażonych), u których wynik testu na przeciwciała anty-HIV będzie dodatni, wśród 100 tys. losowo przebadanych osób:
  3. Prawdopodobieństwo, że pacjent z dodatnim wynikiem testu na przeciwciała anty-HIV jest zakażony HIV:

14.4. (0–1)

Oceń, czy poniższe interpretacje przedstawionych wyników badań trojga pacjentów są prawidłowe. Zaznacz T (tak), jeśli interpretacja jest prawidłowa, albo N (nie) – jeśli jest nieprawidłowa.

1. U pacjenta 1. wynik testu na przeciwciała anty-HIV był fałszywie dodatni, o czym świadczy wykluczenie zakażenia na podstawie wyników PCR. T N
2. Wyniki testu PCR dla pacjenta 2. są niewiarygodne ze względu na dodatni wynik w próbie kontrolnej negatywnej – należy powtórzyć badanie. T N
3. Dodatkowe badanie techniką PCR potwierdziło podejrzenie, że pacjent 3. jest zakażony HIV. T N

14.5. (0–1)

Wyjaśnij, dlaczego testy wykrywające przeciwciała anty-HIV nie nadają się do diagnostyki zakażeń HIV u noworodków i niemowląt urodzonych przez matki zakażone HIV. W odpowiedzi uwzględnij spodziewany wynik testu oraz funkcjonowanie układu odpornościowego matki.

14.6. (0–1)

Oceń, czy poniższe osoby znajdują się w grupie zwiększonego ryzyka zakażenia HIV. Zaznacz T (tak), jeśli się w niej znajdują, albo N (nie) – jeśli w niej się nie znajdują.

1. Osoby przebywające w jednym pomieszczeniu z osobami zakażonymi HIV, np. w pracy lub szkole. T N
2. Osoby narażone na częste ukąszenia komarów i innych owadów odżywiających się krwią. T N
3. Sąsiedzi osób zakażonych HIV, mieszkający w tym samym domu wielorodzinnym. T N
4

Informator CKE, Poziom rozszerzony (Formuła 2023)Zadanie 16. (2 pkt)

Ewolucjonizm i historia życia na ziemi Kręgowce Uzupełnij/narysuj wykres, schemat lub tabelę Zamknięte (np. testowe, prawda/fałsz)

Przez długi czas uważano, że walenie (Cetacea) – wodne ssaki, do których zaliczamy m.in. delfina butlonosego i płetwala błękitnego – są spokrewnione z lądowymi ssakami drapieżnymi. Jednak już w latach 70. ubiegłego wieku odkryto skamieniałość wymarłego ssaka Indohyus indirae, którego czaszka zawierała struktury występujące współcześnie jedynie u waleni, natomiast szkielet pozaczaszkowy wskazywał na pokrewieństwo z parzystokopytnymi. Ten ssak prawdopodobnie prowadził wodno-lądowy tryb życia. Badania molekularne potwierdziły, że walenie wywodzą się spośród parzystokopytnych, a ich najbliższymi żyjącymi krewnymi są przedstawiciele monofiletycznej rodziny hipopotamowatych – hipopotamy nilowy i karłowaty. Dalszymi krewnymi są inne parzystokopytne, np. kozica, a jeszcze dalszymi − ssaki nieparzystokopytne, np. koń Przewalskiego.

16.1. (0–1)

Na podstawie tekstu określ pokrewieństwo ewolucyjne między wymienionymi zwierzętami – narysuj brakujące gałęzie drzewa filogenetycznego tak, aby drzewo odzwierciedlało w poprawny sposób to pokrewieństwo.

16.2. (0–1)

Spośród A–D wybierz i zaznacz cechę, która występuje u wszystkich ssaków i wyłącznie u nich.

  1. Włosy obecne przynajmniej w trakcie życia płodowego.
  2. Gruczoły wydzielnicze w skórze właściwej.
  3. Błony płodowe.
  4. Łożysko.
5

Matura Marzec 2021, Poziom rozszerzony (Formuła 2015)Zadanie 6. (3 pkt)

Nasienne Uzupełnij/narysuj wykres, schemat lub tabelę Podaj/wymień

Na schemacie przedstawiono rozwój gametofitu żeńskiego rośliny okrytonasiennej.
Uwaga: Nie zachowano proporcji wielkości struktur.

Na podstawie: M. Podbielkowska, Z. Podbielkowski, Biologia z higieną i ochroną środowiska, Warszawa 1995.

6.1. (0–1)

Na powyższym schemacie zaznacz moment, w którym dochodzi do mejozy. Wpisz literę R nad odpowiednią strzałką.

6.2. (0–1)

Podaj ploidalność (1n, 2n lub 3n) komórki macierzystej makrospor oraz komórek zalążka oznaczonych na schemacie literami A i D.

Komórka macierzysta makrospor:

Komórki zalążka:    A. ,   D. .

6.3. (0–1)

Zapisz nazwy komórek woreczka zalążkowego, z którymi łączą się jądra plemnikowe, oraz podaj ich oznaczenia literowe ze schematu.

6

Matura Maj 2021, Poziom rozszerzony (Formuła 2015)Zadanie 11. (3 pkt)

Układ pokarmowy i żywienie Układ hormonalny Uzupełnij/narysuj wykres, schemat lub tabelę Podaj i uzasadnij/wyjaśnij Podaj/wymień

Trzustka jest gruczołem, który pełni u człowieka jednocześnie funkcję wydzielania wewnętrznego oraz zewnętrznego. Funkcja zewnątrzwydzielnicza polega na wytwarzaniu enzymów trawiennych i na uwalnianiu ich do światła przewodu pokarmowego.

Na podstawie: K. Sembulingam, P. Sembulingam, Essentials of Medical Physiology, 2012;
P. Hoser, Fizjologia organizmów z elementami anatomii człowieka, Warszawa 2000.

11.1. (0–1)

Uzupełnij tabelę – wpisz nazwy enzymów trzustkowych i substratu w odpowiednie miejsca.

Nazwa enzymu Trawiony składnik pokarmowy (substrat)
trypsyna
polisacharydy
zemulgowane tłuszcze

11.2. (0–1)

Podaj nazwę odcinka przewodu pokarmowego, do którego są wydzielane enzymy trzustkowe.

11.3. (0–1)

Wykaż, że trzustka pełni funkcję gruczołu wydzielania wewnętrznego. W odpowiedzi uwzględnij przykład substancji produkowanej przez ten narząd oraz sposób jej wydzielania.

7

Matura Marzec 2021, Poziom rozszerzony (Formuła 2015)Zadanie 18. (3 pkt)

Genetyka - pozostałe Uzupełnij/narysuj wykres, schemat lub tabelę Zamknięte (np. testowe, prawda/fałsz) Podaj i uzasadnij/wyjaśnij

Mutacja genowa może być mutacją punktową, ale może też polegać na podstawieniu, wstawieniu bądź wycięciu większego odcinka DNA.

Na schemacie strzałkami oznaczono podstawienia nukleotydowe w łańcuchu DNA.

18.1. (0–1)

Uzupełnij schemat – wpisz w wyznaczone kropkami miejsca symbole trzech pozostałych nukleotydów w taki sposób, aby schemat prawidłowo ilustrował transwersje – podstawienia nukleotydu purynowego na pirymidynowy i odwrotnie.

18.2. (0–1)

Określ, która z mutacji – insercja pojedynczego nukleotydu czy podstawienie – może spowodować zmianę ramki odczytu w sekwencji kodującej białko. Odpowiedź uzasadnij.

18.3. (0–1)

Oceń, czy poniższe informacje dotyczące mutacji są prawdziwe. Zaznacz P, jeśli informacja jest prawdziwa, albo F – jeśli jest fałszywa.

1. Konsekwencją mutacji genowej w pierwszej pozycji kodonu jest zwykle zmiana struktury pierwszorzędowej białka kodowanego przez ten gen. P F
2. U roślin okrytozalążkowych rozmnażających się generatywnie mutacje somatyczne mogą być przekazywane potomstwu. P F
3. Aneuploidie polegają na utracie lub występowaniu dodatkowych pojedynczych chromosomów. P F
8

Matura Maj 2020, Poziom podstawowy (Formuła 2007)Zadanie 8. (3 pkt)

Układ krążenia Uzupełnij/narysuj wykres, schemat lub tabelę Podaj/wymień
a)Uzupełnij poniższy schemat tak, aby prawidłowo ilustrował krążenie krwi w dużym i małym obiegu krwi człowieka. Wpisz w wyznaczone miejsca nazwy obiegów krwi oraz właściwe nazwy naczyń krwionośnych – wybierz je spośród wymienionych poniżej.
żyły główne
tętnice płucne
aorta
żyły płucne

1. Obieg

lewa komora.....................tkanki ciała.....................prawy przedsionek

2. Obieg

prawa komora.....................płuca.....................lewy przedsionek

b)Określ rolę małego obiegu krwi w funkcjonowaniu organizmu człowieka.
9

Matura Maj 2020, Poziom podstawowy (Formuła 2007)Zadanie 15. (2 pkt)

Układ rozrodczy Uzupełnij/narysuj wykres, schemat lub tabelę Podaj i uzasadnij/wyjaśnij

Na rysunku przedstawiono w sposób uproszczony wybrane narządy wchodzące w skład układu rozrodczego kobiety i etapy cyklu jajnikowego.

Na podstawie: https://en.m.wikipedia.org

a)Uporządkuj etapy cyklu jajnikowego – wpisz numery 2.–5. w odpowiednie miejsca tabeli.
Etapy cyklu jajnikowego Kolejność
Zanik ciałka żółtego.
Owulacja.
Wzrost pęcherzyków pierwotnych. 1.
Powstanie ciałka żółtego.
Dojrzewanie pęcherzyka Graafa.
b)Podaj nazwę narządu oznaczonego na rysunku literą X oraz określ funkcję, jaką ten narząd pełni podczas rozrodu.
10

Matura Maj 2020, Poziom podstawowy (Formuła 2007)Zadanie 24. (2 pkt)

Ekologia Uzupełnij/narysuj wykres, schemat lub tabelę

Mszyce są owadami, które wysysają sok z łyka roślin. Te soki zawierają dużo wody i cukrów, a mało innych substancji odżywczych. Dlatego mszyce wydalają nadmiar wody z cukrami (tzw. spadź), które są chętnie spijane przez mrówki. Mrówki te zapewniają mszycom ochronę przed ich naturalnymi wrogami – biedronkami.

Ze względu na możliwość wykorzystania biedronki do walki z mszycami sprowadzono do Europy biedronkę azjatycką, która zjada więcej mszyc niż nasza rodzima biedronka siedmiokropka. Biedronka azjatycka żywi się nie tylko mszycami, lecz także larwami innych biedronek.

Na podstawie przedstawionych informacji określ i wpisz w tabelę nazwy trzech różnych antagonistycznych zależności międzygatunkowych oraz podaj przykłady tych zależności.

Nazwa zależności Przykład
1.                                                            
2.                                                            
3.                                                            

Strony