Anatomia i fizjologia zwierząt

Oto lista zadań maturalnych z danego działu biologii. Aby skorzystać z dodatkowych opcji lub wybrać zadania z pozostałych działów kliknij poniżej.

Przejdź do wyszukiwarki zadań

 

Matura Lipiec 2020, Poziom rozszerzony (Formuła 2015)Zadanie 16. (2 pkt)

Układ rozrodczy Podaj/wymień Podaj i uzasadnij/wyjaśnij

Na poniższym schemacie przedstawiono płód oraz krążenie łożyskowe.

Na podstawie: P. Murphy, Biology. Revision for Leaving Certificate, Dublin 2003.

16.1. (0–1)

Podaj nazwę błony płodowej oznaczonej na schemacie literą X.

16.2. (0–1)

Określ, w którym naczyniu – w tętnicy macicy czy w tętnicy pępowinowej – płynie krew o większym stopniu natlenowania. Odpowiedź uzasadnij.

Matura Lipiec 2020, Poziom rozszerzony (Formuła 2015)Zadanie 15. (2 pkt)

Układ nerwowy i narządy zmysłów Zamknięte (np. testowe, prawda/fałsz) Podaj/wymień

Ośrodki położone w mózgowiu człowieka są odpowiedzialne za ruchy złożone, w których wykonywanie zaangażowanych jest wiele grup mięśniowych, oraz za uruchamianie mechanizmów zapewniających utrzymanie równowagi ciała, gdyż każdy ruch prowadzi do przesunięcia środka ciężkości ciała i do zaburzenia dotychczasowej jego pozycji.

Na podstawie: M. Tafil-Klawe, J. Klawe, Wykłady z fizjologii człowieka, Warszawa 2009.

15.1. (0–1)

Na podstawie: https://qbi.uq.edu.au/brain/brain-anatomy/lobes-brain

Wybierz z rysunku i zapisz literę, którą oznaczono położenie pól ruchowych ośrodków korowych.

15.2. (0–1)

Do wybranych etapów (1.–3.) składających się na wykonanie ruchu złożonego przyporządkuj po jednej odpowiedniej strukturze mózgowia (A–D) biorącej w nim główny udział. Wpisz oznaczenia literowe w odpowiednie komórki tabeli.

  1. móżdżek
  2. pola czuciowe kory mózgowej
  3. pola kojarzeniowe kory mózgowej
  4. pola ruchowe kory mózgowej
Etapy składające się na wykonanie ruchu Struktury mózgowia
1. Analiza skutków planowanego ruchu.
2. Przekazanie pobudzenia do określonych grup neuronów rdzeniowych biorących udział w ruchu.
3. Regulacja napięcia mięśniowego, utrzymanie równowagi.

Matura Czerwiec 2021, Poziom rozszerzony (Formuła 2015)Zadanie 15. (3 pkt)

Układ hormonalny Zamknięte (np. testowe, prawda/fałsz) Podaj i uzasadnij/wyjaśnij

Adrenalina to hormon, który mobilizuje organizm do działania w warunkach krótkotrwałego stresu.

Na schemacie przedstawiono występowanie receptorów dla adrenaliny (adrenergicznych) typu α i typu β w różnych rodzajach komórek organizmu człowieka oraz reakcję tych komórek na adrenalinę.

Na podstawie: J.B. Reece, L.A. Urry, M.L. Cain, S.A. Wasserman, P.V. Minorsky, R.B. Jackson, Campbell Biology, 10th ed., Stany Zjednoczone 2014.

15.1. (0–1)

Na podstawie schematu oceń, które stwierdzenia dotyczące oddziaływania adrenaliny na komórki docelowe są prawdziwe. Zaznacz P, jeśli stwierdzenie jest prawdziwe, albo F – jeśli jest fałszywe.

1. Tylko te komórki organizmu, które mają odpowiednie receptory adrenergiczne, są wrażliwe na adrenalinę. P F
2. Efekt działania adrenaliny na komórkę mięśni gładkich w naczyniach krwionośnych zależy od typu receptora występującego na jej powierzchni. P F
3. Różne komórki organizmu wyposażone w ten sam typ receptora dla adrenaliny wykazują taki sam efekt fizjologiczny. P F

15.2. (0–1)

Uzupełnij poniższe zdania tak, aby zawierały one prawdziwe informacje dotyczące efektów działania adrenaliny w warunkach krótkotrwałego stresu. W każdym nawiasie podkreśl właściwe określenie.

Adrenalina wydzielana jest przez (korę nadnerczy / rdzeń nadnerczy). Wyzwala ona rozkład glikogenu w komórkach wątroby oraz (zmniejsza / zwiększa) dopływ krwi do mięśni szkieletowych, równocześnie (zmniejszając / zwiększając) dopływ krwi do ścian przewodu pokarmowego.

15.3. (0–1)

Określ, czy adrenalina jest hormonem steroidowym, czy – pochodną aminokwasu. Odpowiedź uzasadnij, porównując lokalizację komórkową receptorów adrenergicznych z typową lokalizacją receptorów dla obu rodzajów hormonów.

Matura Czerwiec 2021, Poziom rozszerzony (Formuła 2015)Zadanie 14. (2 pkt)

Układ immunologiczny Choroby człowieka Podaj i uzasadnij/wyjaśnij

Wirusowe zapalenie wątroby typu C (WZW C) jest wywoływane zakażeniem przez wirus zapalenia wątroby typu C (HCV). Źródłem zakażenia jest krew. Warunkiem przeniesienia zakażenia na inną osobę jest naruszenie ciągłości tkanek (przekłucie lub uszkodzenie skóry lub błony śluzowej), przez które wirus może dostać się do krwi. Jedną z zasad profilaktyki zakażenia HCV jest używanie rękawiczek ochronnych przez personel medyczny, kosmetyczki, czy inne osoby, które w związku z wykonywaną pracą mogą mieć kontakt z krwią innych ludzi. Aby zdiagnozować zakażenie HCV, w pierwszej kolejności wykonuje się badanie krwi pacjenta, mające na celu wykrycie przeciwciał anty-HCV. Jednak nie zawsze obecność przeciwciał anty-HCV we krwi świadczy o aktywnym zakażeniu wirusem HCV. Z tego powodu po wykryciu przeciwciał anty-HCV wykonuje się kolejne badanie, czyli test na obecność materiału genetycznego tego wirusa (RNA HCV). Dodatni wynik tego testu oznacza, że we krwi wykazana została obecność materiału genetycznego HCV, co świadczy o aktywnym zakażeniu, a u pacjenta może rozwinąć się zapalenie wątroby.

Wiele osób zakażonych HCV przez długi czas nie ma objawów choroby i czuje się dobrze. Niestety do tej pory nie ma dostępnej skutecznej szczepionki przeciw HCV.

Na podstawie: http://www.hcv.pzh.gov.pl

14.1. (0–1)

Wyjaśnij, dlaczego obecność przeciwciał anty-HCV we krwi badanej osoby nie zawsze świadczy o obecności tego wirusa w organizmie tej osoby.

14.2. (0–1)

Uzasadnij, że w celu zapobiegania zakażeniu HCV nie wystarczy, aby osoba pobierająca krew pracowała w rękawiczkach ochronnych, ale powinna zmieniać te rękawiczki po każdym pacjencie.

Matura Czerwiec 2021, Poziom rozszerzony (Formuła 2015)Zadanie 13. (3 pkt)

Układ powłokowy Zamknięte (np. testowe, prawda/fałsz) Podaj/wymień

Zewnętrzną warstwę skóry człowieka tworzy naskórek, który składa się z kilku warstw i nie jest ukrwiony ani unerwiony. Najgłębiej położona jest warstwa podstawna, w której komórki stale się dzielą. Przez nowo powstające komórki tej warstwy są wypychane ku górze te, które powstały wcześniej. Przesuwające się w górę komórki naskórka, zwane keratynocytami, produkują keratynę – białko warunkujące wytrzymałość mechaniczną naskórka oraz sprawiające, że jest on nieprzepuszczalny dla wody. W miarę przesuwania się ku powierzchni keratynocyty obumierają i tworzą warstwę zrogowaciałą, której zewnętrzna warstwa nieustannie się złuszcza. W warstwie podstawnej naskórka występują również melanocyty, wytwarzające melaniny, czyli barwniki nadające skórze barwę. Melaniny gromadzą się w melanosomach, które przemieszczają się w wypustkach melanocytów do wyższych warstw komórek naskórka.

Na rysunku przedstawiono budowę skóry człowieka oraz budowę okrywającej ją warstwy naskórka.

Na podstawie: http://www.fea-sas.com/melanine.php;
T. Le, K. Krause, First aid for the basic sciences. General Principles, 2009.

13.1. (0–1)

Oceń, które stwierdzenia dotyczące budowy skóry człowieka są prawdziwe. Zaznacz P, jeśli stwierdzenie jest prawdziwe, albo F – jeśli jest fałszywe.

1. Naskórek jest zbudowany z nabłonka wielowarstwowego płaskiego rogowaciejącego. P F
2. Włosy i gruczoły łojowe są wytworami naskórka. P F
3. Zrogowaciała warstwa naskórka chroni skórę przed wnikaniem drobnoustrojów. P F

13.2. (0–1)

Określ, jakie znaczenie dla funkcjonowania komórek tworzących żywą warstwę naskórka ma charakterystyczne pofałdowanie granicy naskórka i skóry właściwej, widoczne na rysunku.

13.3. (0–1)

Podaj znaczenie adaptacyjne melanin znajdujących się w górnych warstwach naskórka.

Matura Czerwiec 2021, Poziom rozszerzony (Formuła 2015)Zadanie 12. (3 pkt)

Układ pokarmowy i żywienie Uzupełnij/narysuj wykres, schemat lub tabelę Zamknięte (np. testowe, prawda/fałsz) Podaj/wymień

W żołądku człowieka wyróżnia się następujące części: wpustową, dno żołądka, trzon żołądka i część odźwiernikową. Błona śluzowa wyściełająca żołądek jest silnie pofałdowana. Występują w niej gruczoły wytwarzające pepsynogen oraz komórki okładzinowe wytwarzające kwas solny. W części odźwiernikowej żołądka występują liczne gruczoły wytwarzające śluz. Mieszanie się masy pokarmowej w żołądku, w wyniku skurczów perystaltycznych, jest procesem stosunkowo powolnym. Na rysunku przedstawiono żołądek i dwunastnicę człowieka oraz gruczoły związane z tym odcinkiem jelita.

Na podstawie: https://schoolworkhelper.net

12.1. (0–1)

Uzupełnij tabelę – podaj nazwy narządów oznaczonych na rysunku literami X i Y oraz określ znaczenie tych narządów dla trawienia tłuszczów.

Struktura Nazwa narządu Znaczenie narządu
X
Y

12.2. (0–1)

Podaj dwie funkcje, które pełni w żołądku kwas solny.

12.3. (0–1)

Oceń, które informacje dotyczące żołądka są prawdziwe. Zaznacz P, jeśli informacja jest prawdziwa, albo F – jeśli jest fałszywa.

1. Mięśniówka żołądka jest zbudowana z mięśni gładkich. P F
2. Rozciąganie ścian żołądka przez pokarm trafiający do niego jest czynnikiem stymulującym skurcze mięśniówki żołądka. P F
3. Skurcze odźwiernika zapobiegają cofaniu się treści żołądkowej do przełyku. P F

Matura Czerwiec 2021, Poziom rozszerzony (Formuła 2015)Zadanie 11. (3 pkt)

Układ pokarmowy i żywienie Podaj i uzasadnij/wyjaśnij Podaj/wymień

Adaptacje ssaków do odżywiania się określonym rodzajem pokarmu dotyczą budowy układu pokarmowego i często są związane z zależnościami międzygatunkowymi, np. w różnych częściach przewodu pokarmowego ssaków roślinożernych żyją drobnoustroje, które ułatwiają trawienie pokarmu.

Na rysunkach przedstawiono budowę układu pokarmowego dwóch ssaków: kojota i koali, mających zbliżone rozmiary ciała, ale odżywiających się różnym rodzajem pokarmu.

Na podstawie: Biologia, pod red. N.A. Campbella, Poznań 2012.

11.1. (0–2)

Określ, na którym rysunku – A czy B – przedstawiono budowę układu pokarmowego roślinożercy. Odpowiedź uzasadnij, podając dwie widoczne na rysunku cechy budowy tego układu stanowiące przystosowania do roślinożerności, oraz określ, na czym te przystosowania polegają.

Układ pokarmowy ssaka roślinożernego przedstawiono na rysunku: ,
ponieważ:

11.2. (0–1)

Podaj nazwę składnika pokarmowego występującego w dużej ilości w diecie ssaków roślinożernych, który nie jest trawiony samodzielnie przez zwierzęta, ale trawią go mikroorganizmy żyjące w ich przewodach pokarmowych.

Matura Czerwiec 2021, Poziom rozszerzony (Formuła 2015)Zadanie 10. (3 pkt)

Układ krążenia Zamknięte (np. testowe, prawda/fałsz) Podaj/wymień

Na schemacie A przedstawiono procesy związane z transportem CO2 i zachodzące w ludzkim erytrocycie znajdującym się w naczyniach włosowatych tkanek obwodowych. Na wykresie B przedstawiono krzywe dysocjacji CO2 dla hemoglobiny utlenowanej i odtlenowanej.

Na podstawie: I. Kay, Wprowadzenie do fizjologii zwierząt, Warszawa 2001.

10.1. (0–1)

Określ, które stwierdzenia dotyczące transportu CO2 we krwi człowieka są prawdziwe. Zaznacz P, jeśli stwierdzenie jest prawdziwe, albo F – jeśli jest fałszywe.

1. Część CO2 powstającego w tkankach rozpuszcza się w osoczu krwi i w tej postaci jest transportowana. P F
2. Jony HCO3, które są jedną z form transportu CO2 we krwi, powstają w erytrocytach dzięki reakcji katalizowanej przez anhydrazę węglanową. P F
3. Jony HCO3 są transportowane przez błonę erytrocytu na zasadzie dyfuzji prostej. P F

10.2. (0–1)

Określ dominujący kierunek reakcji katalizowanej przez anhydrazę węglanową w erytrocytach znajdujących się w naczyniach włosowatych płuc – podaj substraty i produkty tej reakcji.

Substraty:
Produkty:

10.3. (0–1)

Na podstawie informacji przedstawionych na wykresie B uzupełnij poniższe zdanie tak, aby zawierało ono informacje prawdziwe. W każdym nawiasie podkreśl właściwe określenie.

Utlenowanie hemoglobiny w płucach powoduje, że CO2 jest od niej (łatwiej / trudniej) odłączany, natomiast w tkankach, gdy hemoglobina oddaje tlen, (zwiększa się / zmniejsza się) jej powinowactwo do CO2.

Informator CKE, Poziom rozszerzony (Formuła 2023)Zadanie 14. (8 pkt)

Metody badawcze i doświadczenia Ekspresja informacji genetycznej Choroby człowieka Układ immunologiczny Uzupełnij/narysuj wykres, schemat lub tabelę Zamknięte (np. testowe, prawda/fałsz) Podaj i uzasadnij/wyjaśnij

Współcześnie stosuje się dwie podstawowe metody wykrywania zakażeń HIV. Rutynowe badanie polega na wykrywaniu przeciwciał anty-HIV w surowicy pacjenta. W przypadku tej metody czułość badania, czyli prawdopodobieństwo otrzymania wyniku dodatniego u osoby chorej, tzn. wykrycia zakażenia, wynosi 100%, ale wynik dodatni otrzymuje się także dla 0,5% zdrowych osób – specyficzność wynosi 99,5%. Dlatego postawienie diagnozy zakażenia HIV wymaga potwierdzenia dodatkowym badaniem za pomocą metody PCR, wykrywającym gen odwrotnej transkryptazy wbudowany w genom gospodarza. Ta metoda jest teoretycznie bezbłędna pod warunkiem utrzymywania wysokich standardów pracy laboratoryjnej. Odpowiednie próby kontrolne służą sprawdzeniu, czy:

  • polimeraza DNA nie utraciła aktywności podczas przechowywania (kontrola pozytywna),
  • wszystkie odczynniki są wolne od wirusowego materiału genetycznego (kontrola negatywna).

Dla trzech pacjentów uzyskano dodatni wynik testu na obecność przeciwciał anty-HIV. Z tego powodu lekarz zlecił dodatkowe badanie z wykorzystaniem metody PCR, którego wyniki podsumowano w poniższej tabeli.

Próba
badawcza kontrolna pozytywna kontrolna negatywna
Pacjent 1. +
Pacjent 2. + + +
Pacjent 3. + +

Na podstawie: GenBank sekwencja nr KR861191.1; M. Fearon, The Laboratory Diagnosis of HIV Infections, „Can J Dis Med Microbiol” 16, 2005, s. 26–30;
D.S Boyle i inni, Rapid Detection of HIV-1 Proviral DNA for Early Infant Diagnosis Using Recombinase Polymerase Amplification, „mBio” 4, 2013, e00135–13;
S. Koblavi-Dème i inni, Sensitivity and Specificity of Human Immunodeficiency Virus Rapid Serologic Assays and Testing Algorithms in an Antenatal Clinic in Abidjan, Ivory Coast, „J Clin Microbiol” 39, 2001, s. 1808–1812.

14.1. (0–2)

Zaprojektuj doświadczenie PCR wykrywające DNA HIV wbudowane w genom gospodarza. Dla każdej z prób – badawczej, kontrolnej pozytywnej i kontrolnej negatywnej – wybierz wszystkie właściwe składniki mieszaniny reakcyjnej. Wpisz w tabelę znak „+”, jeśli składnik należy dodać do próby, albo znak „–”, jeśli ten składnik należy pominąć.

Próba
badawcza kontrolna pozytywna kontrolna negatywna
DNA genomowy wyizolowany od pacjenta
DNA genomowy wyizolowany z linii komórkowej zakażonej HIV
para specyficznych starterów
bufor zapewniający optymalne pH i stężenie jonów Mg2+
termostabilna polimeraza DNA
mieszanina deoksyrybonukleotydów

14.2. (0–1)

Wybierz spośród A–D i zaznacz prawidłowe sekwencje starterów polF1 i polR1, wykorzystywanych w teście diagnostycznym HIV, przyłączających się do zaznaczonych fragmentów poniższej sekwencji genu odwrotnej transkryptazy wirusa HIV, wbudowanej w genom gospodarza.

  1. polF1 5′ CCCTACAATCCCCAAAGTCAAGGAGTAGTAGAA 3′
    polR1 5′ CTCTGGAAAGGTGAAGGGGCAGTAGTAATACA 3′
  2. polF1 5′ TTCTACTACTCCTTGACTTTGGGGATTGTAGGG 3′
    polR1 5′ TGTATTACTACTGCCCCTTCACCTTTCCAGAG 3′
  3. polF1 5′ CCCTACAATCCCCAAAGTCAAGGAGTAGTAGAA 3′
    polR1 5′ TGTATTACTACTGCCCCTTCACCTTTCCAGAG 3′
  4. polF1 5′ TTCTACTACTCCTTGACTTTGGGGATTGTAGGG 3′
    polR1 5′ CTCTGGAAAGGTGAAGGGGCAGTAGTAATACA 3′

14.3. (0–2)

Przed zabiegiem chirurgicznym pacjentowi wykonano testy na nosicielstwo wirusa HIV wykrywające przeciwciała anty-HIV. Wynik wyszedł dodatni. Pacjent nie znajduje się w żadnej z grup ryzyka zakażenia HIV. Według oficjalnych danych częstość występowania zakażenia HIV w Polsce wynosi ok. 40 osób na 100 tys.

Oblicz prawdopodobieństwo, że pacjent jest zakażony HIV, z uwzględnieniem czułości i specyficzności testu na przeciwciała anty-HIV. Zapisz obliczenia w wyznaczonych miejscach 1.–3.

  1. Oczekiwana liczba osób zakażonych HIV, u których wynik testu na przeciwciała anty-HIV będzie dodatni, wśród 100 tys. losowo przebadanych osób:
  2. Oczekiwana liczba osób zdrowych (niezakażonych), u których wynik testu na przeciwciała anty-HIV będzie dodatni, wśród 100 tys. losowo przebadanych osób:
  3. Prawdopodobieństwo, że pacjent z dodatnim wynikiem testu na przeciwciała anty-HIV jest zakażony HIV:

14.4. (0–1)

Oceń, czy poniższe interpretacje przedstawionych wyników badań trojga pacjentów są prawidłowe. Zaznacz T (tak), jeśli interpretacja jest prawidłowa, albo N (nie) – jeśli jest nieprawidłowa.

1. U pacjenta 1. wynik testu na przeciwciała anty-HIV był fałszywie dodatni, o czym świadczy wykluczenie zakażenia na podstawie wyników PCR. T N
2. Wyniki testu PCR dla pacjenta 2. są niewiarygodne ze względu na dodatni wynik w próbie kontrolnej negatywnej – należy powtórzyć badanie. T N
3. Dodatkowe badanie techniką PCR potwierdziło podejrzenie, że pacjent 3. jest zakażony HIV. T N

14.5. (0–1)

Wyjaśnij, dlaczego testy wykrywające przeciwciała anty-HIV nie nadają się do diagnostyki zakażeń HIV u noworodków i niemowląt urodzonych przez matki zakażone HIV. W odpowiedzi uwzględnij spodziewany wynik testu oraz funkcjonowanie układu odpornościowego matki.

14.6. (0–1)

Oceń, czy poniższe osoby znajdują się w grupie zwiększonego ryzyka zakażenia HIV. Zaznacz T (tak), jeśli się w niej znajdują, albo N (nie) – jeśli w niej się nie znajdują.

1. Osoby przebywające w jednym pomieszczeniu z osobami zakażonymi HIV, np. w pracy lub szkole. T N
2. Osoby narażone na częste ukąszenia komarów i innych owadów odżywiających się krwią. T N
3. Sąsiedzi osób zakażonych HIV, mieszkający w tym samym domu wielorodzinnym. T N

Biomedica 2022, Poziom rozszerzony (Formuła 2015)Zadanie 25. (2 pkt)

Układ immunologiczny Zamknięte (np. testowe, prawda/fałsz)

Uzupełnij poniższy tekst tak, aby stanowił poprawną całość, podkreślając właściwy wyraz.

Immunoglobuliny występują w płynach ustrojowych wszystkich kręgowców / bezkręgowców. Wyróżniamy pięć klas immunoglobulin: IgA, IgE, IgG, IgD, IgM. Immunoglobuliny wykazują / nie wykazują powinowactwa do antygenów. Immunoglobuliny są wytwarzane przez plazmocyty będące pobudzonymi limfocytami T / B. Immunoglobuliny mogą wiązać / nie mogą wiązać toksyn(y). Immunoglobuliny odpowiadają / nie odpowiadają za indukcję immunofagocytozy. Przeciwciała należą do odpowiedzi immunologicznej nieswoistej / swoistej.

To zadanie pochodzi ze zbioru matura 2022 wydawnictwa Biomedica
Kup pełny zbiór zadań

Biomedica 2022, Poziom rozszerzony (Formuła 2015)Zadanie 24. (3 pkt)

Układ oddechowy Podaj i uzasadnij/wyjaśnij Podaj/wymień

Poniżej przedstawiono schematycznie budowę pęcherzyków płucnych: prawidłowego oraz dotkniętych kilkoma zmianami patologicznymi.

24.1. (0–1)

Na podstawie schematu wyjaśnij, dlaczego wystąpi spadek intensywności dyfuzji pęcherzykowej w pęcherzyku oznaczonym literą C.

24.2. (0–1)

Wyjaśnij, dlaczego mimo prawidłowej budowy pęcherzyka płucnego oznaczonego literą F, dochodzi do spadku intensywności dyfuzji.

24.3. (0–1)

Na podstawie wniosków podanych w zad. 24.1-24.2 podaj dwa czynniki, od których zależy intensywność dyfuzji gazów oddechowych w płucach.

To zadanie pochodzi ze zbioru matura 2022 wydawnictwa Biomedica
Kup pełny zbiór zadań

Biomedica 2022, Poziom rozszerzony (Formuła 2015)Zadanie 23. (2 pkt)

Układ hormonalny Układ wydalniczy Podaj i uzasadnij/wyjaśnij Podaj/wymień

W procesie wytwarzania moczu powstaje początkowo mocz pierwotny, który podlega wielu skomplikowanym przemianom, mającym na celu m.in. jego zagęszczenie i powstanie finalnie moczu ostatecznego.

23.1. (0–1)

Wyjaśnij, jak zmieni się objętość moczu ostatecznego w przypadku niedoboru wazopresyny. Odpowiedź uzasadnij.

23.2. (0–1)

Wymień dwie różnice między moczem pierwotnym a ostatecznym w warunkach fizjologicznych.

To zadanie pochodzi ze zbioru matura 2022 wydawnictwa Biomedica
Kup pełny zbiór zadań

Biomedica 2022, Poziom rozszerzony (Formuła 2015)Zadanie 22. (3 pkt)

Układ rozrodczy Zamknięte (np. testowe, prawda/fałsz) Podaj i uzasadnij/wyjaśnij Podaj/wymień

Dojrzały plemnik człowieka jest wysoce zróżnicowaną i jedną z najmniejszych komórek rozrodczych występujących u ssaków.

22.1. (0–1)

Podaj, czy dojrzałe plemniki są komórkami zdolnymi do podziałów.

22.2. (0–1)

Oceń prawdziwość poniższych stwierdzeń zaznaczając P – jeśli zdanie jest prawdziwe lub F – jeśli zdanie jest fałszywe.

1. Wyróżniamy plemniki X i plemniki Y w zależności od zawartych w nich chromosomów płciowych. P F
2. Dojrzały plemnik składa się z główki, wstawki, szyjki i witki. P F
3. Główka plemnika zawiera jądro komórkowe 1n o skondensowanej chromatynie, niewielką ilość cytoplazmy oraz akrosom. P F
4. Akrosom powstaje ze zlania się pęcherzyków aparatów Golgiego. P F
5. Szyjka jest najkrótszą częścią plemnika. P F

22.3. (0–1)

Główka plemnika zawiera jądro komórkowe (1n) o skondensowanej chromatynie. Wyjaśnij, dlaczego skondensowana chromatyna w jądrach plemników sprawdza się lepiej podczas wędrówki plemników w drogach rodnych samicy od chromatyny luźnej.

To zadanie pochodzi ze zbioru matura 2022 wydawnictwa Biomedica
Kup pełny zbiór zadań

Biomedica 2022, Poziom rozszerzony (Formuła 2015)Zadanie 21. (3 pkt)

Układ krążenia Choroby człowieka Podaj i uzasadnij/wyjaśnij Podaj/wymień

Ośrodki automatyzmu serca tworzą zmodyfikowane włókna mięśniowe przypominające komórki embrionalne, posiadające zdolność do rytmicznego samopobudzania.

21.1. (0–1)

Podaj nazwę nadrzędnego ośrodka automatyzmu pracy serca.

21.2. (0–1)

W przypadku zatrzymania akcji serca konieczne jest wykonywanie pośredniego masażu serca poprzez rytmiczne uciskanie mostka na głębokość 5-6 centymetrów, w tempie ok. 120 ucisków na minutę. Wyjaśnij, dlaczego konieczne jest, aby rozpocząć masaż jak najszybciej od chwili ustania pracy serca.

21.3. (0–1)

Podaj, jakiego rodzaju leczenie można zastosować (prócz farmakoterapii) przy defektach pracy ośrodków automatyzmu serca.

To zadanie pochodzi ze zbioru matura 2022 wydawnictwa Biomedica
Kup pełny zbiór zadań

Biomedica 2022, Poziom rozszerzony (Formuła 2015)Zadanie 20. (4 pkt)

Układ pokarmowy i żywienie Podaj i uzasadnij/wyjaśnij Podaj/wymień

Poniższe zdjęcie przedstawia fragment preparatu histologicznego żołądka. Błona śluzowa żołądka wysłana jest nabłonkiem jednowarstwowym sześciennym. W obrębie błony śluzowej żołądka znajdują się gruczoły żołądkowe właściwe, w skład których wchodzą komórki główne produkujące pepsynogen - nieaktywną formę enzymu, która dopiero po aktywacji przekształca się w aktywną pepsynę. W skład gruczołów właściwych żołądka wchodzą także komórki śluzowe, które wytwarzają śluz będący mieszaniną wody, glikoprotein i proteoglikanów. Komórki okładzinowe zaopatrzone są w bardzo liczne mitochondria, których obecność związana jest z aktywnym transportem jonów H+ i Cl- do światła żołądka.

Numerem 3 oznaczono komórki główne odpowiedzialne za wytwarzanie pepsynogenu. Numerem 4 oznaczono komórki okładzinowe. Numer 1 przedstawia mięśniówkę żołądka.

20.1. (0–1)

Podaj nazwę substancji produkowanej przez komórki okładzinowe żołądka, która wpływa na przekształcenie nieaktywnego pepsynogenu w aktywną pepsynę.

20.2. (0–1)

Wyjaśnij, dlaczego komórki główne produkują enzym w formie nieaktywnej.

20.3. (0–1)

Podaj nazwę komórek produkujących wydzielinę stanowiącą ochronę ścian żołądka przed samostrawieniem.

20.4. (0–1)

Określ, czy nabłonek jednowarstwowy walcowaty wyściela powierzchnie wszystkich elementów przewodu pokarmowego.

To zadanie pochodzi ze zbioru matura 2022 wydawnictwa Biomedica
Kup pełny zbiór zadań

Biomedica 2022, Poziom rozszerzony (Formuła 2015)Zadanie 19. (3 pkt)

Układ hormonalny Podaj/wymień

Przysadka mózgowa pełni funkcję regulatora innych gruczołów. Produkuje hormony sterujące wydzielaniem tarczycy, nadnerczy i gonad. Przysadka pełni także funkcję magazynującą i wydzielającą hormony wytwarzane przez podwzgórze.

19.1. (0–1)

Podaj nazwy dwóch hormonów magazynowanych przez przysadkę.

19.2. (0–1)

Niedobór pewnego hormonu przysadki objawia się brakiem laktacji po porodzie oraz przerzedzeniem owłosienia łonowego. Podaj nazwę lub skrót tego hormonu.

19.3. (0–1)

Pewien hormon u kobiet stymuluje wzrost pęcherzyków jajnikowych oraz wytwarzanie i uwalnianie estrogenów. U mężczyzn stymuluje spermatogenezę. Podaj nazwę lub skrót tego hormonu.

To zadanie pochodzi ze zbioru matura 2022 wydawnictwa Biomedica
Kup pełny zbiór zadań

Biomedica 2022, Poziom rozszerzony (Formuła 2015)Zadanie 18. (3 pkt)

Układ nerwowy i narządy zmysłów Podaj i uzasadnij/wyjaśnij Podaj/wymień

Odruch bezwarunkowy to reakcja wrodzona, prosta, automatyczna, zachodząca bez świadomości (nerwy wywołują odruch pobudzając mięśnie przed powiadomieniem mózgu).

18.1. (0–1)

Podaj dwa przykłady odruchów bezwarunkowych występujących u dorosłego człowieka.

18.2. (0–1)

Odruch warunkowy został odkryty przez rosyjskiego fizjologa, Iwana Pawłowa. Wyjaśnij zasadę powstawania odruchu warunkowego.

18.3. (0–1)

Odruchy bezwarunkowe występują również u noworodków. Wyróżniamy np. odruch płaczu, odruch szukania i ssania, odruch chwytny. Określ, czy odruchy bezwarunkowe wraz z wiekiem mogą zanikać, czy pozostają przez całe życie osobnicze.

To zadanie pochodzi ze zbioru matura 2022 wydawnictwa Biomedica
Kup pełny zbiór zadań

Biomedica 2022, Poziom rozszerzony (Formuła 2015)Zadanie 17. (2 pkt)

Układ kostny i mięśniowy Choroby człowieka Podaj/wymień

Kręgosłup dzieli się na 5 odcinków: szyjny (7 kręgów), piersiowy (12), lędźwiowy (5), krzyżowy (5 zrośniętych z kością krzyżową), ogonowy (guziczny) (3-5) – zrośniętych w pojedynczą kość ogonową (guziczną). Kształt kręgosłupa oscyluje wokół litery „S”, posiada fizjologiczne krzywizny: odcinek szyjny i lędźwiowy wygięte są do przodu (lordoza), a piersiowy i krzyżowy do tyłu– kifoza.

17.1. (0–1)

Podaj, jakie znaczenia mają fizjologiczne krzywizny kręgosłupa.

17.2. (0–1)

U niektórych osób prowadzących siedzący tryb życia może wystąpić boczne skrzywienie kręgosłupa. Podaj nazwę tego schorzenia.

To zadanie pochodzi ze zbioru matura 2022 wydawnictwa Biomedica
Kup pełny zbiór zadań

Biomedica 2022, Poziom rozszerzony (Formuła 2015)Zadanie 16. (3 pkt)

Enzymy Układ pokarmowy i żywienie Metody badawcze i doświadczenia Podaj/wymień

Studenci biologii przeprowadzili pewien eksperyment.

Jak pokazano na powyższym schemacie, do probówek oznaczonych numerami od 1 do 3 dodawano nieznany enzym w celu jego identyfikacji. W każdej z probówek znajdowała się ta sama ilość białka.
Probówki różniły się wartością pH:
1 ⟶ pH = 1,5
2 ⟶ pH = 7
3 ⟶ pH = 9

Po 10 minutach od dodania tej samej ilości ENZYMU TRAWIENNEGO wykazano, że białko uległo strawieniu tylko w probówce nr 1.

16.1. (0–1)

Podaj nazwę enzymu trawiennego dodanego do probówek.

16.2. (0–1)

Podaj problem badawczy do przeprowadzonego eksperymentu.

16.3. (0–1)

Podaj, dlaczego białko uległo strawieniu tylko w probówce nr 1.

To zadanie pochodzi ze zbioru matura 2022 wydawnictwa Biomedica
Kup pełny zbiór zadań

Informator CKE, Poziom rozszerzony (Formuła 2023)Zadanie 10. (3 pkt)

Układ kostny i mięśniowy Układ oddechowy Podaj i uzasadnij/wyjaśnij Zamknięte (np. testowe, prawda/fałsz) Uzupełnij/narysuj wykres, schemat lub tabelę

Mioglobina jest białkiem występującym w mięśniach kręgowców. U ssaków nurkujących służy jako magazyn tlenu: pozwala na pracę mięśni w warunkach chwilowego niedotlenienia całego organizmu. Natomiast obecność mioglobiny w mięśniach pozostałych ssaków przede wszystkim wpływa na efektywność dyfuzji tlenu z krwi do mięśni.

Na poniższym wykresie przedstawiono powinowactwo mioglobiny do tlenu oraz powinowactwo hemoglobiny do tlenu w pięciu różnych pH.

Na podstawie: R.G. Garrett, C.M. Grisham, Biochemistry, University of Virginia 2010, s. 474; J.M. Berg, J.L. Tymoczko, L. Stryer, Biochemia, Warszawa 2009, s. 183–193.

10.1. (0–1)

Określ, jaki wpływ na dyfuzję tlenu z krwi do włókien mięśniowych ma mioglobina występująca w cytozolu tych komórek. Odpowiedź uzasadnij, odnosząc się do danych przedstawionych na wykresie.

10.2. (0–1)

Uzupełnij poniższe zdanie tak, aby w poprawny sposób opisywało ono procesy wymiany gazowej zachodzące w płucach człowieka. W każdym nawiasie podkreśl właściwe określenie.

Podczas wymiany gazowej w płucach człowieka dyfuzja CO2 z krwi do pęcherzyków płucnych jest przyczyną (wzrostu / spadku) pH krwi, a dzięki temu następuje (wzrost / spadek) powinowactwa hemoglobiny do tlenu.

10.3. (0–1)

Uzupełnij poniższy schemat tak, aby poprawnie ilustrował drogę tlenu z powietrza pęcherzykowego, aż do jego wykorzystania w procesie tlenowego oddychania wewnątrzkomórkowego. Wpisz we właściwe miejsca wymienione poniżej nazwy.

oksymioglobina
oksyhemoglobina
mitochondrium

tlen cząsteczkowy →

Strony