Anatomia i fizjologia człowieka

Arkusz pokazowy CKE Marzec 2022, Poziom rozszerzony (Formuła 2023)Zadanie 15. (3 pkt)

Układ nerwowy i narządy zmysłów Ewolucjonizm i historia życia na ziemi Dziedziczenie Podaj/wymień Podaj i uzasadnij/wyjaśnij

Achromatopsja to całkowita ślepota na barwy, która jest warunkowana przez recesywny allel autosomalny (a). Osoba dotknięta tą chorobą widzi świat jedynie w czerni, bieli i odcieniach szarości ze względu na brak jednego z typów komórek światłoczułych w gałce ocznej. Jest to bardzo rzadkie zaburzenie – na świecie występuje z częstością 0,005%, ale aż 8% mieszkańców Pingelap – małej, izolowanej wyspy na Oceanie Spokojnym – wykazuje objawy achromatopsji.

Przyczyny tego stanu rzeczy upatruje się w niszczycielskim tajfunie, który uderzył w wyspę Pingelap w 1775 r. i spowodował śmierć 90% jej mieszkańców. Kataklizm przeżyło tylko 20 osób i to one z czasem odnowiły populację Pingelap. Wszystko wskazuje na to, że jeden z ocalałych mężczyzn był nosicielem achromatopsji. Ponadto w tak małej i izolowanej populacji nie dało się uniknąć kojarzenia krewniaczego.

Na podstawie: S.S. Mader, M. Windelspecht, Biology. 12th Edition, Nowy Jork 2016.

15.1. (0–1)

Podaj nazwę typu komórek światłoczułych, których brakuje u osób chorych na achromatopsję.

15.2. (0–1)

Wyjaśnij, dlaczego śmierć 90% mieszkańców wyspy Pingelap w 1775 r. doprowadziła do zwiększonej współcześnie częstości występowania achromatopsji w tej populacji. W odpowiedzi uwzględnij genetyczne podłoże zjawiska.

15.3. (0–1)

Wykaż, że już w drugim pokoleniu po przejściu tajfunu w populacji mogły się pojawić osoby z objawami achromatopsji. Uzupełnij szachownice Punetta – w odpowiednie miejsca wpisz genotypy gamet oraz genotypy potomstwa.

Arkusz pokazowy CKE Marzec 2022, Poziom rozszerzony (Formuła 2023)Zadanie 12. (3 pkt)

Choroby człowieka Układ pokarmowy i żywienie Podaj i uzasadnij/wyjaśnij Podaj/wymień

Krzywica to choroba skutkująca zmianami w układzie kostnym, których przyczyną są zaburzenia gospodarki wapniowo-fosforanowej. W Wielkiej Brytanii w ciągu dwóch ostatnich dekad podwoiła się liczba dzieci hospitalizowanych z powodu krzywicy. Przyczyn zaczęto szukać w rozpowszechnianiu się niezdrowych nawyków żywieniowych, a także w mniejszej ilości czasu, jaką spędzają małe dzieci na świeżym powietrzu. Tymczasem klimatolodzy twierdzą, że może stać za tym obserwowany w Wielkiej Brytanii wyraźny wzrost zachmurzenia w ciepłej połowie roku.

Na podstawie: M. Goldacre i inni, Hospitalisation for children with rickets in England: a historical perspective, „Lancet” 383, 2014; www.oil.org.pl; ncez.pzh.gov.pl

12.1. (0–1)

Wykaż, że wzrost zachmurzenia w Wielkiej Brytanii może być przyczyną zwiększonej zachorowalności dzieci na krzywicę.

12.2. (0–2)

Podaj dwa przykłady nawyków żywieniowych będących czynnikami ryzyka krzywicy u dzieci.

Arkusz pokazowy CKE Marzec 2022, Poziom rozszerzony (Formuła 2023)Zadanie 8. (3 pkt)

Układ krążenia Uzupełnij/narysuj wykres, schemat lub tabelę Podaj i uzasadnij/wyjaśnij

Na rysunku przedstawiono budowę serca człowieka. Literami A–D oznaczono niektóre z głównych naczyń krwionośnych, a literą E – jedną z zastawek.

Na podstawie: www.cardio-research.com/basic-anatomy-of-the-human-heart

8.1. (0–2)

Uzupełnij tabelę – dla każdego z naczyń krwionośnych A–D wybierz właściwy obieg krwi oraz kierunek przepływu krwi. Wpisz znak X w odpowiednie komórki tabeli.

Naczynie krwionośne Element obiegu Kierunek przepływu krwi
dużego
(ustrojowego)
małego
(płucnego)
do serca od serca
A
B
C
D

8.2. (0–1)

Podaj nazwę zastawki oznaczonej na rysunku literą E oraz określ przyczynę zamykania się tej zastawki. W odpowiedzi uwzględnij różnicę ciśnień między jamami serca rozdzielanymi przez tę zastawkę.

Nazwa zastawki:

Przyczyna zamknięcia zastawki:

Arkusz pokazowy CKE Marzec 2022, Poziom rozszerzony (Formuła 2023)Zadanie 7. (3 pkt)

Układ immunologiczny Uzupełnij/narysuj wykres, schemat lub tabelę Zamknięte (np. testowe, prawda/fałsz)

W przebiegu odpowiedzi immunologicznej w organizmie człowieka są wytwarzane różne klasy przeciwciał:

  • immunoglobuliny M (IgM) – produkowane na początku odpowiedzi immunologicznej
  • immunoglobuliny G (IgG) – pojawiają się później, a ich wysokie stężenie utrzymuje się przez dłuższy okres w surowicy krwi i limfie. Są to jedyne przeciwciała przechodzące przez łożysko.

Oznaczanie w surowicy pacjenta przeciwciał klasy IgG i IgM swoistych dla określonego antygenu stosuje się często w celach diagnostycznych. Takie badania serologiczne są podstawą diagnostyki w kierunku toksoplazmozy u kobiet w ciąży.

Na poniższym schemacie przedstawiono zmiany stężenia przeciwciał IgG i IgM po zarażeniu Toxoplasma gondii.

Na podstawie: J.G. Montoya, Laboratory diagnosis of Toxoplasma gondii infection and toxoplasmosis, „The Journal of Infectious Diseases” 185, 2002.

7.1. (0–2)

Uzupełnij tabelę – do każdego z wyników badania wykrywającego obecność przeciwciał skierowanych przeciwko T. gondii dobierz jego właściwą interpretację spośród podanych (A–C).

  1. świadczy o braku odporności
  2. świadczy o przebytym w przeszłości zarażeniu
  3. świadczy o aktywnej, rozwijającej się inwazji pasożyta
Wynik badania serologicznego Interpretacja wyniku
IgM (–), IgG (–)
IgM (–), IgG (+)

7.2. (0–1)

Dokończ zdanie. Zaznacz właściwą odpowiedź spośród podanych.

Na skutek przechodzenia przez łożysko matczynych przeciwciał klasy IgG noworodek w sposób naturalny nabywa odporności

  1. swoistej biernej.
  2. swoistej czynnej.
  3. nieswoistej biernej.
  4. nieswoistej czynnej.

Matura Czerwiec 2022, Poziom rozszerzony (Formuła 2015)Zadanie 14. (3 pkt)

Układ krążenia Ewolucjonizm i historia życia na ziemi Zamknięte (np. testowe, prawda/fałsz) Pozostałe

Kontakt erytrocytów mających w błonie komórkowej określony antygen ze skierowanym przeciwko niemu przeciwciałem obecnym w surowicy krwi skutkuje aglutynacją – zlepianiem się krwinek. Z tego powodu przetoczenie krwi niezgodnej pod względem grupy układu AB0 i czynnika Rh stanowi zagrożenie życia.

W celu potwierdzenia u pacjenta grupy krwi B Rh(–) wykonano test aglutynacji, stosując trzy rodzaje surowic:

  1. z przeciwciałami anty-A
  2. z przeciwciałami anty-B
  3. z przeciwciałami anty-Rh (inaczej anty-D).

14.1. (0–2)

Określ, jaki wynik będzie jednoznacznie potwierdzać grupę krwi B Rh(–) tego pacjenta. Zaznacz w tabeli literę T (tak), jeśli w danej probówce dojdzie do aglutynacji, albo N (nie) – jeśli do niej nie dojdzie.

Przeciwciało Aglutynacja
anty-A T N
anty-B T N
anty-Rh T N

14.2. (0–1)

Około 16% Europejczyków ma krew Rh(–). Za brak czynnika Rh odpowiada recesywny allel d.

Korzystając z prawa Hardy’ego-Weinberga, oblicz częstość występowania heterozygot w tej populacji. Zapisz obliczenia.

Częstość wynosi: %

Matura Czerwiec 2022, Poziom rozszerzony (Formuła 2015)Zadanie 13. (3 pkt)

Układ pokarmowy i żywienie Układ krążenia Uzupełnij/narysuj wykres, schemat lub tabelę Podaj i uzasadnij/wyjaśnij

Wątroba dorosłego człowieka waży około 1,5 kg i jest jednym z nielicznych narządów, które ze względu na pełnione funkcje mają dwa rodzaje unaczynienia:

  • unaczynienie czynnościowe, związane z transportem do wątroby wchłoniętych w jelicie składników pokarmowych
  • unaczynienie odżywcze, którego zadaniem jest m.in. dostarczanie tlenu do komórek wątroby.
Na podstawie: B. Gołąb, W.Z. Traczyk, Anatomia i fizjologia człowieka, Łódź 1997;
W.Z. Traczyk, Fizjologia człowieka w zarysie, Warszawa 2016.

13.1. (0–1)

Uzupełnij tabelę dotyczącą unaczynienia wątroby – wpisz w odpowiednie miejsca tabeli nazwy wymienionych naczyń krwionośnych.

tętnica wątrobowa
żyła wątrobowa
żyła wrotna
Unaczynienie Naczynie doprowadzające Naczynie odprowadzające
czynnościowe
odżywcze

13.2. (0–1)

Określ, czy wytwarzanie żółci przez wątrobę to funkcja wewnątrzwydzielnicza, czy – zewnątrzwydzielnicza. Odpowiedź uzasadnij.

13.3. (0–1)

Uzupełnij poniższe zdania dotyczące wątroby tak, aby zawierały informacje prawdziwe. W każdym nawiasie podkreśl właściwe określenie.

Komórki wątroby magazynują (skrobię / glikogen). Obniżenie stężenia glukozy we krwi powoduje uwolnienie glukozy (z wątroby do krwi / z krwi do wątroby). W wątrobie magazynowane są również kwasy tłuszczowe, trójglicerydy i cholesterol, a wraz z nimi witaminy rozpuszczalne w tłuszczach: (witaminy B i C / witaminy E i K).

Matura Czerwiec 2022, Poziom rozszerzony (Formuła 2015)Zadanie 12. (4 pkt)

Układ krążenia Podaj i uzasadnij/wyjaśnij Zamknięte (np. testowe, prawda/fałsz)

Do mikrokrążenia, oprócz naczyń włosowatych, zaliczamy również znajdujące się w wielu narządach tętniczki i żyłki. Małe naczynia łączące tętniczki z żyłkami to tzw. metarteriole (metatętniczki), od których odchodzi sieć naczyń włosowatych. We wszystkich ujściach metarterioli do naczyń włosowatych znajdują się mięśnie gładkie zwane zwieraczami przedkapilarnymi. Mogą one zamykać się lub otwierać. W warunkach spoczynku tylko przez 25% naczyń włosowatych przepływa krew.

Na schematach przedstawiono mikrokrążenie przy otwartych (schemat I) i zamkniętych (schemat II) zwieraczach przedkapilarnych.

Na podstawie: E.P. Solomon, L.R. Berg, D.W. Martin, C.A. Ville, Biologia, Warszawa 1996; W.Z. Traczyk, A. Trzebski, Fizjologia człowieka z elementami fizjologii stosowanej i klinicznej, Warszawa 2015; teachmephysiology.com

12.1. (0–1)

Określ, który ze schematów – I czy II – przedstawia mikrokrążenie w pracującym mięśniu szkieletowym. Odpowiedź uzasadnij.

12.2. (0–1)

Przedstaw sposób, w jaki jest regulowany przepływ krwi przez tętnice i tętniczki.

12.3. (0–2)

Oceń, czy poniższe stwierdzenia dotyczące mikrokrążenia są prawdziwe. Zaznacz P, jeśli stwierdzenie jest prawdziwe, albo F – jeśli jest fałszywe.

1. Gdyby doszło do jednoczesnego rozluźnienia wszystkich zwieraczy przedkapilarnych w organizmie, nastąpiłby duży spadek ciśnienia krwi. P F
2. Naczynia włosowate, podobnie jak żyły i tętnice, mają budowę trójwarstwową, dzięki czemu mogą zwężać swoje światło. P F
3. Zaburzenie mikrokrążenia w danym narządzie może doprowadzić do niewydolności tego narządu. P F

Matura Czerwiec 2022, Poziom rozszerzony (Formuła 2015)Zadanie 11. (5 pkt)

Budowa i funkcje komórki Układ pokarmowy i żywienie Zamknięte (np. testowe, prawda/fałsz) Podaj i uzasadnij/wyjaśnij

Główną funkcją nabłonka wyścielającego żołądek jest wydzielanie kwasu solnego i enzymów trawiennych. Ten nabłonek zawiera również komórki wydzielające hormony oraz komórki wytwarzające śluz. Komórki żołądka produkujące kwas solny noszą nazwę komórek okładzinowych. Są one duże, z centralnie położonym jądrem i licznymi mitochondriami. W ich błonie komórkowej znajdują się głębokie, wyścielone mikrokosmkami wpuklenia, tzw. kanaliki.

Na rysunku przedstawiono budowę komórki okładzinowej żołądka człowieka.

Na podstawie: A. Stevens, J.S. Lowe, Histologia człowieka, Warszawa, Bremen 2000; A.C. Engevik, I. Kaji, J.R. Goldenring, The Physiology of the Gastric Parietal Cell, „Physiological Reviews” 2020.

11.1. (0–2)

Wypisz z tekstu dwie cechy komórek okładzinowych człowieka, które są przystosowaniem do wydzielania kwasu solnego, oraz określ, na czym polega każde z tych przystosowań.

11.2. (0–2)

Oceń, czy poniższe stwierdzenia dotyczące kwasu solnego produkowanego przez komórki okładzinowe człowieka są prawdziwe. Zaznacz P, jeśli stwierdzenie jest prawdziwe, albo F – jeśli jest fałszywe.

1. Kwas solny umożliwia przekształcenie pepsynogenu w pepsynę. P F
2. Kwas solny denaturuje białka, ułatwiając ich enzymatyczne trawienie przez pepsynę. P F
3. Kwas solny ułatwia enzymatyczne trawienie skrobi przez amylazę ślinową. P F

11.3. (0–1)

Przedstaw rolę, jaką spełnia śluz produkowany przez komórki żołądka w funkcjonowaniu tego narządu.

Matura Czerwiec 2022, Poziom rozszerzony (Formuła 2015)Zadanie 9. (4 pkt)

Nicienie Układ krążenia Choroby człowieka Uzupełnij/narysuj wykres, schemat lub tabelę Podaj i uzasadnij/wyjaśnij

Obecnie uważa się, że glista ludzka i świńska należą do tego samego gatunku – Ascaris lumbricoides. Glista ta pasożytuje w jelicie cienkim swego żywiciela, wywołując chorobę zwaną glistnicą. Wydalone wraz z kałem zapłodnione jaja pasożyta rozwijają się w glebie – tworzy się wtedy w jajach pierwsza postać larwalna, a po linieniu kolejna, i w ten sposób jaja dojrzewają do postaci inwazyjnej. Wykazano, że jajo może zachować żywotność w środowisku przez kilka lat. Zarażenie następuje przez zjedzenie jaj inwazyjnych, z których w jelicie cienkim wykluwają się larwy. Larwy wraz z krwią wędrują do płuc. W pęcherzykach płucnych dwukrotnie linieją, skąd przez drogi oddechowe wracają do układu pokarmowego, by ponownie umiejscowić się w jelicie cienkim, gdzie glisty osiągają dojrzałość płciową.

Na podstawie: T. Kłapeć, A. Cholewa, Zagrożenia dla zdrowia związane ze stosowaniem nawozów organicznych i organiczno-mineralnych, „Medycyna Ogólna i Nauki o Zdrowiu” 18(2), 2012.

9.1. (0–1)

Korzystając ze schematu przedstawiającego układ krwionośny człowieka, uporządkuj drogę larw glisty ludzkiej. Wpisz w tabelę kolejne numery tak, aby przedstawiały one wędrówkę larw z jelita cienkiego do płuc.

jelito cienkie 1
żyła główna dolna
żyła wrotna
serce
żyła wątrobowa
tętnice płucne
naczynia krwionośne wątroby
płuca 8
Na podstawie: commons.wikimedia.org

9.2. (0–1)

Wykaż, że podczas wędrówki w organizmie człowieka larwy glisty ludzkiej uszkadzają śródbłonek naczyń włosowatych płuc.

9.3. (0–1)

Wyjaśnij, dlaczego jaja A. lumbricoides stanowią zagrożenie dla potencjalnego żywiciela dopiero po pewnym czasie od ich złożenia.

9.4. (0–1)

Na podstawie tekstu wykaż, że stosowanie odchodów świń jako naturalnego nawozu może przyczynić się do rozwoju glistnicy u ludzi.

Matura Czerwiec 2022, Poziom rozszerzony (Formuła 2015)Zadanie 1. (3 pkt)

Skład organizmów Układ pokarmowy i żywienie Zamknięte (np. testowe, prawda/fałsz) Podaj i uzasadnij/wyjaśnij

Wolne żelazo jest toksyczne dla komórek i z tego powodu jest ono prawie u wszystkich organizmów magazynowane w cytoplazmie w postaci metaloproteiny – ferrytyny. Białko to składa się z 24 łańcuchów polipeptydowych. U kręgowców występują dwa rodzaje takich łańcuchów: ciężkie (H) i lekkie (L). We wnętrzu ferrytyny może gromadzić się do 4500 atomów żelaza w postaci związków mineralnych. W wysokich stężeniach ferrytyna występuje w wątrobie i nerkach.

Na poniższym rysunku przedstawiono budowę zewnętrzną oraz przekrój przez cząsteczkę ludzkiej ferrytyny, zbudowanej wyłącznie z łańcuchów ciężkich. Kolorami oznaczono poszczególne łańcuchy polipeptydowe.

Na podstawie: J.M. Berg, J.L. Tymoczko, L. Stryer, Biochemia, Warszawa 2009; J. Gałązka-Friedman, A. Friedman, Żelazo w neurodegeneracji, „Kosmos” 63, 2014; pdb101.rcsb.org/motm/35

1.1. (0–1)

Na podstawie przedstawionych informacji określ najwyższą rzędowość struktury białka – ferrytyny. Odpowiedź uzasadnij, odnosząc się do budowy ferrytyny.

1.2. (0–1)

Uzupełnij poniższe zdania dotyczące znaczenia żelaza w organizmie człowieka tak, aby zawierały informacje prawdziwe. W każdym nawiasie podkreśl właściwe określenie.

Żelazo to istotny (mikroelement / makroelement) w organizmie człowieka, który wchodzi m.in. w skład (tyroksyny / hemoglobiny). Niedobór żelaza jest jedną z przyczyn (anemii / niedoczynności tarczycy).

1.3. (0–1)

Które spośród podanych produktów spożywczych są bogatym źródłem żelaza w diecie człowieka? Zaznacz dwie odpowiedzi spośród podanych.

  1. mięso
  2. olej słonecznikowy
  3. wątroba drobiowa
  4. mleko
  5. owoce

Matura Maj 2022, Poziom rozszerzony (Formuła 2015)Zadanie 15. (4 pkt)

Ewolucjonizm i historia życia na ziemi Choroby człowieka Układ pokarmowy i żywienie Zamknięte (np. testowe, prawda/fałsz)

Wspólny przodek wyższych naczelnych utracił w wyniku mutacji zdolność do syntezy witaminy C. Ta mutacja zaszła w genie kodującym oksydazę gulonolaktonową – enzym katalizujący ostatni etap syntezy kwasu askorbinowego. Przy dużej podaży witaminy C w pokarmie został osłabiony dobór eliminujący osobniki niezdolne do jej syntezy, a dryf genetyczny utrwalił tę – zasadniczo nieszkodliwą – mutację.

Czynnik transkrypcyjny HIF-1 uruchamia ekspresję genów odpowiedzialnych za adaptację organizmu do zmniejszonego stężenia tlenu (hipoksji). Efekty działania HIF-1 obejmują m.in. rozrost naczyń krwionośnych w tkankach. Białko HIF-1 jest stale produkowane przez komórkę, ale w warunkach normalnego stężenia tlenu jest szybko degradowane, a proces jego rozkładu rozpoczyna się od hydroksylacji jednej z dwóch reszt proliny. Specyficzne hydroksylazy katalizujące tę reakcję wymagają do działania obecności witaminy C.

Duże dawki witaminy C są stosowane w leczeniu nowotworów rozwijających się w wyniku nieprawidłowej regulacji poziomu HIF-1.

Na podstawie: H. Pontzer, Stworzeni do ruchu, „Świat Nauki” 2, 2019; H.J. Knowles i in., Effect of ascorbate on the activity of hypoxia-inducible factor and cancer cells, „Cancer Research” 63(8), 2003.

15.1. (0–2)

Oceń, czy poniższe stwierdzenia dotyczące witaminy C są prawdziwe. Zaznacz P, jeśli stwierdzenie jest prawdziwe, albo F – jeśli jest fałszywe.

1. Skutkiem mutacji w genie kodującym oksydazę gulonolaktonową jest zablokowanie szlaku metabolicznego syntezy witaminy C. P F
2. Dieta bogata w witaminę C była jedną z przyczyn utrwalenia mutacji uniemożliwiającej syntezę tej witaminy u przodka wyższych naczelnych. P F
3. Witamina C może dzięki właściwościom przeciwutleniającym obniżać stężenie wolnych rodników w komórkach. P F

15.2. (0–1)

Uzupełnij poniższe zdania tak, aby zawierały prawdziwe informacje. Podkreśl w każdym nawiasie właściwe określenie.

Duże dawki witaminy C powodują (wzrost / spadek) aktywności hydroksylaz HIF-1, co prowadzi do (wzrostu / spadku) stężenia HIF-1 w komórkach nowotworowych. Dzięki temu zostaje (pobudzony / zahamowany) rozwój naczyń krwionośnych w guzie nowotworowym.

15.3. (0–1)

Dokończ zdanie. Zaznacz właściwą odpowiedź spośród podanych.

Charakterystycznym objawem niedoboru witaminy C jest

  1. utrata ostrości widzenia.
  2. zmniejszenie krzepliwości krwi.
  3. suchość i nadmierne rogowacenie skóry.
  4. osłabienie i pękanie ścian naczyń krwionośnych.

Matura Lipiec 2020, Poziom rozszerzony (Formuła 2015)Zadanie 16. (2 pkt)

Układ rozrodczy Podaj/wymień Podaj i uzasadnij/wyjaśnij

Na poniższym schemacie przedstawiono płód oraz krążenie łożyskowe.

Na podstawie: P. Murphy, Biology. Revision for Leaving Certificate, Dublin 2003.

16.1. (0–1)

Podaj nazwę błony płodowej oznaczonej na schemacie literą X.

16.2. (0–1)

Określ, w którym naczyniu – w tętnicy macicy czy w tętnicy pępowinowej – płynie krew o większym stopniu natlenowania. Odpowiedź uzasadnij.

Matura Lipiec 2020, Poziom rozszerzony (Formuła 2015)Zadanie 15. (2 pkt)

Układ nerwowy i narządy zmysłów Zamknięte (np. testowe, prawda/fałsz) Podaj/wymień

Ośrodki położone w mózgowiu człowieka są odpowiedzialne za ruchy złożone, w których wykonywanie zaangażowanych jest wiele grup mięśniowych, oraz za uruchamianie mechanizmów zapewniających utrzymanie równowagi ciała, gdyż każdy ruch prowadzi do przesunięcia środka ciężkości ciała i do zaburzenia dotychczasowej jego pozycji.

Na podstawie: M. Tafil-Klawe, J. Klawe, Wykłady z fizjologii człowieka, Warszawa 2009.

15.1. (0–1)

Na podstawie: https://qbi.uq.edu.au/brain/brain-anatomy/lobes-brain

Wybierz z rysunku i zapisz literę, którą oznaczono położenie pól ruchowych ośrodków korowych.

15.2. (0–1)

Do wybranych etapów (1.–3.) składających się na wykonanie ruchu złożonego przyporządkuj po jednej odpowiedniej strukturze mózgowia (A–D) biorącej w nim główny udział. Wpisz oznaczenia literowe w odpowiednie komórki tabeli.

  1. móżdżek
  2. pola czuciowe kory mózgowej
  3. pola kojarzeniowe kory mózgowej
  4. pola ruchowe kory mózgowej
Etapy składające się na wykonanie ruchu Struktury mózgowia
1. Analiza skutków planowanego ruchu.
2. Przekazanie pobudzenia do określonych grup neuronów rdzeniowych biorących udział w ruchu.
3. Regulacja napięcia mięśniowego, utrzymanie równowagi.

Matura Czerwiec 2021, Poziom rozszerzony (Formuła 2015)Zadanie 15. (3 pkt)

Układ hormonalny Zamknięte (np. testowe, prawda/fałsz) Podaj i uzasadnij/wyjaśnij

Adrenalina to hormon, który mobilizuje organizm do działania w warunkach krótkotrwałego stresu.

Na schemacie przedstawiono występowanie receptorów dla adrenaliny (adrenergicznych) typu α i typu β w różnych rodzajach komórek organizmu człowieka oraz reakcję tych komórek na adrenalinę.

Na podstawie: J.B. Reece, L.A. Urry, M.L. Cain, S.A. Wasserman, P.V. Minorsky, R.B. Jackson, Campbell Biology, 10th ed., Stany Zjednoczone 2014.

15.1. (0–1)

Na podstawie schematu oceń, które stwierdzenia dotyczące oddziaływania adrenaliny na komórki docelowe są prawdziwe. Zaznacz P, jeśli stwierdzenie jest prawdziwe, albo F – jeśli jest fałszywe.

1. Tylko te komórki organizmu, które mają odpowiednie receptory adrenergiczne, są wrażliwe na adrenalinę. P F
2. Efekt działania adrenaliny na komórkę mięśni gładkich w naczyniach krwionośnych zależy od typu receptora występującego na jej powierzchni. P F
3. Różne komórki organizmu wyposażone w ten sam typ receptora dla adrenaliny wykazują taki sam efekt fizjologiczny. P F

15.2. (0–1)

Uzupełnij poniższe zdania tak, aby zawierały one prawdziwe informacje dotyczące efektów działania adrenaliny w warunkach krótkotrwałego stresu. W każdym nawiasie podkreśl właściwe określenie.

Adrenalina wydzielana jest przez (korę nadnerczy / rdzeń nadnerczy). Wyzwala ona rozkład glikogenu w komórkach wątroby oraz (zmniejsza / zwiększa) dopływ krwi do mięśni szkieletowych, równocześnie (zmniejszając / zwiększając) dopływ krwi do ścian przewodu pokarmowego.

15.3. (0–1)

Określ, czy adrenalina jest hormonem steroidowym, czy – pochodną aminokwasu. Odpowiedź uzasadnij, porównując lokalizację komórkową receptorów adrenergicznych z typową lokalizacją receptorów dla obu rodzajów hormonów.

Matura Czerwiec 2021, Poziom rozszerzony (Formuła 2015)Zadanie 14. (2 pkt)

Układ immunologiczny Choroby człowieka Podaj i uzasadnij/wyjaśnij

Wirusowe zapalenie wątroby typu C (WZW C) jest wywoływane zakażeniem przez wirus zapalenia wątroby typu C (HCV). Źródłem zakażenia jest krew. Warunkiem przeniesienia zakażenia na inną osobę jest naruszenie ciągłości tkanek (przekłucie lub uszkodzenie skóry lub błony śluzowej), przez które wirus może dostać się do krwi. Jedną z zasad profilaktyki zakażenia HCV jest używanie rękawiczek ochronnych przez personel medyczny, kosmetyczki, czy inne osoby, które w związku z wykonywaną pracą mogą mieć kontakt z krwią innych ludzi. Aby zdiagnozować zakażenie HCV, w pierwszej kolejności wykonuje się badanie krwi pacjenta, mające na celu wykrycie przeciwciał anty-HCV. Jednak nie zawsze obecność przeciwciał anty-HCV we krwi świadczy o aktywnym zakażeniu wirusem HCV. Z tego powodu po wykryciu przeciwciał anty-HCV wykonuje się kolejne badanie, czyli test na obecność materiału genetycznego tego wirusa (RNA HCV). Dodatni wynik tego testu oznacza, że we krwi wykazana została obecność materiału genetycznego HCV, co świadczy o aktywnym zakażeniu, a u pacjenta może rozwinąć się zapalenie wątroby.

Wiele osób zakażonych HCV przez długi czas nie ma objawów choroby i czuje się dobrze. Niestety do tej pory nie ma dostępnej skutecznej szczepionki przeciw HCV.

Na podstawie: http://www.hcv.pzh.gov.pl

14.1. (0–1)

Wyjaśnij, dlaczego obecność przeciwciał anty-HCV we krwi badanej osoby nie zawsze świadczy o obecności tego wirusa w organizmie tej osoby.

14.2. (0–1)

Uzasadnij, że w celu zapobiegania zakażeniu HCV nie wystarczy, aby osoba pobierająca krew pracowała w rękawiczkach ochronnych, ale powinna zmieniać te rękawiczki po każdym pacjencie.

Matura Czerwiec 2021, Poziom rozszerzony (Formuła 2015)Zadanie 13. (3 pkt)

Układ powłokowy Zamknięte (np. testowe, prawda/fałsz) Podaj/wymień

Zewnętrzną warstwę skóry człowieka tworzy naskórek, który składa się z kilku warstw i nie jest ukrwiony ani unerwiony. Najgłębiej położona jest warstwa podstawna, w której komórki stale się dzielą. Przez nowo powstające komórki tej warstwy są wypychane ku górze te, które powstały wcześniej. Przesuwające się w górę komórki naskórka, zwane keratynocytami, produkują keratynę – białko warunkujące wytrzymałość mechaniczną naskórka oraz sprawiające, że jest on nieprzepuszczalny dla wody. W miarę przesuwania się ku powierzchni keratynocyty obumierają i tworzą warstwę zrogowaciałą, której zewnętrzna warstwa nieustannie się złuszcza. W warstwie podstawnej naskórka występują również melanocyty, wytwarzające melaniny, czyli barwniki nadające skórze barwę. Melaniny gromadzą się w melanosomach, które przemieszczają się w wypustkach melanocytów do wyższych warstw komórek naskórka.

Na rysunku przedstawiono budowę skóry człowieka oraz budowę okrywającej ją warstwy naskórka.

Na podstawie: http://www.fea-sas.com/melanine.php;
T. Le, K. Krause, First aid for the basic sciences. General Principles, 2009.

13.1. (0–1)

Oceń, które stwierdzenia dotyczące budowy skóry człowieka są prawdziwe. Zaznacz P, jeśli stwierdzenie jest prawdziwe, albo F – jeśli jest fałszywe.

1. Naskórek jest zbudowany z nabłonka wielowarstwowego płaskiego rogowaciejącego. P F
2. Włosy i gruczoły łojowe są wytworami naskórka. P F
3. Zrogowaciała warstwa naskórka chroni skórę przed wnikaniem drobnoustrojów. P F

13.2. (0–1)

Określ, jakie znaczenie dla funkcjonowania komórek tworzących żywą warstwę naskórka ma charakterystyczne pofałdowanie granicy naskórka i skóry właściwej, widoczne na rysunku.

13.3. (0–1)

Podaj znaczenie adaptacyjne melanin znajdujących się w górnych warstwach naskórka.

Matura Czerwiec 2021, Poziom rozszerzony (Formuła 2015)Zadanie 12. (3 pkt)

Układ pokarmowy i żywienie Uzupełnij/narysuj wykres, schemat lub tabelę Zamknięte (np. testowe, prawda/fałsz) Podaj/wymień

W żołądku człowieka wyróżnia się następujące części: wpustową, dno żołądka, trzon żołądka i część odźwiernikową. Błona śluzowa wyściełająca żołądek jest silnie pofałdowana. Występują w niej gruczoły wytwarzające pepsynogen oraz komórki okładzinowe wytwarzające kwas solny. W części odźwiernikowej żołądka występują liczne gruczoły wytwarzające śluz. Mieszanie się masy pokarmowej w żołądku, w wyniku skurczów perystaltycznych, jest procesem stosunkowo powolnym. Na rysunku przedstawiono żołądek i dwunastnicę człowieka oraz gruczoły związane z tym odcinkiem jelita.

Na podstawie: https://schoolworkhelper.net

12.1. (0–1)

Uzupełnij tabelę – podaj nazwy narządów oznaczonych na rysunku literami X i Y oraz określ znaczenie tych narządów dla trawienia tłuszczów.

Struktura Nazwa narządu Znaczenie narządu
X
Y

12.2. (0–1)

Podaj dwie funkcje, które pełni w żołądku kwas solny.

12.3. (0–1)

Oceń, które informacje dotyczące żołądka są prawdziwe. Zaznacz P, jeśli informacja jest prawdziwa, albo F – jeśli jest fałszywa.

1. Mięśniówka żołądka jest zbudowana z mięśni gładkich. P F
2. Rozciąganie ścian żołądka przez pokarm trafiający do niego jest czynnikiem stymulującym skurcze mięśniówki żołądka. P F
3. Skurcze odźwiernika zapobiegają cofaniu się treści żołądkowej do przełyku. P F

Matura Czerwiec 2021, Poziom rozszerzony (Formuła 2015)Zadanie 10. (3 pkt)

Układ krążenia Zamknięte (np. testowe, prawda/fałsz) Podaj/wymień

Na schemacie A przedstawiono procesy związane z transportem CO2 i zachodzące w ludzkim erytrocycie znajdującym się w naczyniach włosowatych tkanek obwodowych. Na wykresie B przedstawiono krzywe dysocjacji CO2 dla hemoglobiny utlenowanej i odtlenowanej.

Na podstawie: I. Kay, Wprowadzenie do fizjologii zwierząt, Warszawa 2001.

10.1. (0–1)

Określ, które stwierdzenia dotyczące transportu CO2 we krwi człowieka są prawdziwe. Zaznacz P, jeśli stwierdzenie jest prawdziwe, albo F – jeśli jest fałszywe.

1. Część CO2 powstającego w tkankach rozpuszcza się w osoczu krwi i w tej postaci jest transportowana. P F
2. Jony HCO3, które są jedną z form transportu CO2 we krwi, powstają w erytrocytach dzięki reakcji katalizowanej przez anhydrazę węglanową. P F
3. Jony HCO3 są transportowane przez błonę erytrocytu na zasadzie dyfuzji prostej. P F

10.2. (0–1)

Określ dominujący kierunek reakcji katalizowanej przez anhydrazę węglanową w erytrocytach znajdujących się w naczyniach włosowatych płuc – podaj substraty i produkty tej reakcji.

Substraty:
Produkty:

10.3. (0–1)

Na podstawie informacji przedstawionych na wykresie B uzupełnij poniższe zdanie tak, aby zawierało ono informacje prawdziwe. W każdym nawiasie podkreśl właściwe określenie.

Utlenowanie hemoglobiny w płucach powoduje, że CO2 jest od niej (łatwiej / trudniej) odłączany, natomiast w tkankach, gdy hemoglobina oddaje tlen, (zwiększa się / zmniejsza się) jej powinowactwo do CO2.

Informator CKE, Poziom rozszerzony (Formuła 2023)Zadanie 14. (8 pkt)

Układ immunologiczny Choroby człowieka Ekspresja informacji genetycznej Metody badawcze i doświadczenia Uzupełnij/narysuj wykres, schemat lub tabelę Zamknięte (np. testowe, prawda/fałsz) Podaj i uzasadnij/wyjaśnij

Współcześnie stosuje się dwie podstawowe metody wykrywania zakażeń HIV. Rutynowe badanie polega na wykrywaniu przeciwciał anty-HIV w surowicy pacjenta. W przypadku tej metody czułość badania, czyli prawdopodobieństwo otrzymania wyniku dodatniego u osoby chorej, tzn. wykrycia zakażenia, wynosi 100%, ale wynik dodatni otrzymuje się także dla 0,5% zdrowych osób – specyficzność wynosi 99,5%. Dlatego postawienie diagnozy zakażenia HIV wymaga potwierdzenia dodatkowym badaniem za pomocą metody PCR, wykrywającym gen odwrotnej transkryptazy wbudowany w genom gospodarza. Ta metoda jest teoretycznie bezbłędna pod warunkiem utrzymywania wysokich standardów pracy laboratoryjnej. Odpowiednie próby kontrolne służą sprawdzeniu, czy:

  • polimeraza DNA nie utraciła aktywności podczas przechowywania (kontrola pozytywna),
  • wszystkie odczynniki są wolne od wirusowego materiału genetycznego (kontrola negatywna).

Dla trzech pacjentów uzyskano dodatni wynik testu na obecność przeciwciał anty-HIV. Z tego powodu lekarz zlecił dodatkowe badanie z wykorzystaniem metody PCR, którego wyniki podsumowano w poniższej tabeli.

Próba
badawcza kontrolna pozytywna kontrolna negatywna
Pacjent 1. +
Pacjent 2. + + +
Pacjent 3. + +
Na podstawie: GenBank sekwencja nr KR861191.1;
M. Fearon, The Laboratory Diagnosis of HIV Infections, „Can J Dis Med Microbiol” 16, 2005, s. 26–30;
D.S Boyle i inni, Rapid Detection of HIV-1 Proviral DNA for Early Infant Diagnosis Using Recombinase Polymerase Amplification, „mBio” 4, 2013, e00135–13;
S. Koblavi-Dème i inni, Sensitivity and Specificity of Human Immunodeficiency Virus Rapid Serologic Assays and Testing Algorithms in an Antenatal Clinic in Abidjan, Ivory Coast, „J Clin Microbiol” 39, 2001, s. 1808–1812.

14.1. (0–2)

Zaprojektuj doświadczenie PCR wykrywające DNA HIV wbudowane w genom gospodarza. Dla każdej z prób – badawczej, kontrolnej pozytywnej i kontrolnej negatywnej – wybierz wszystkie właściwe składniki mieszaniny reakcyjnej. Wpisz w tabelę znak „+”, jeśli składnik należy dodać do próby, albo znak „–”, jeśli ten składnik należy pominąć.

Próba
badawcza kontrolna pozytywna kontrolna negatywna
DNA genomowy wyizolowany od pacjenta
DNA genomowy wyizolowany z linii komórkowej zakażonej HIV
para specyficznych starterów
bufor zapewniający optymalne pH i stężenie jonów Mg2+
termostabilna polimeraza DNA
mieszanina deoksyrybonukleotydów

14.2. (0–1)

Wybierz spośród A–D i zaznacz prawidłowe sekwencje starterów polF1 i polR1, wykorzystywanych w teście diagnostycznym HIV, przyłączających się do zaznaczonych fragmentów poniższej sekwencji genu odwrotnej transkryptazy wirusa HIV, wbudowanej w genom gospodarza.

  1. polF1 5′ CCCTACAATCCCCAAAGTCAAGGAGTAGTAGAA 3′
    polR1 5′ CTCTGGAAAGGTGAAGGGGCAGTAGTAATACA 3′
  2. polF1 5′ TTCTACTACTCCTTGACTTTGGGGATTGTAGGG 3′
    polR1 5′ TGTATTACTACTGCCCCTTCACCTTTCCAGAG 3′
  3. polF1 5′ CCCTACAATCCCCAAAGTCAAGGAGTAGTAGAA 3′
    polR1 5′ TGTATTACTACTGCCCCTTCACCTTTCCAGAG 3′
  4. polF1 5′ TTCTACTACTCCTTGACTTTGGGGATTGTAGGG 3′
    polR1 5′ CTCTGGAAAGGTGAAGGGGCAGTAGTAATACA 3′

14.3. (0–2)

Podpunkt anulowany przez CKE

Przed zabiegiem chirurgicznym pacjentowi wykonano testy na nosicielstwo wirusa HIV wykrywające przeciwciała anty-HIV. Wynik wyszedł dodatni. Pacjent nie znajduje się w żadnej z grup ryzyka zakażenia HIV. Według oficjalnych danych częstość występowania zakażenia HIV w Polsce wynosi ok. 40 osób na 100 tys.

Oblicz prawdopodobieństwo, że pacjent jest zakażony HIV, z uwzględnieniem czułości i specyficzności testu na przeciwciała anty-HIV. Zapisz obliczenia w wyznaczonych miejscach 1.–3.

  1. Oczekiwana liczba osób zakażonych HIV, u których wynik testu na przeciwciała anty-HIV będzie dodatni, wśród 100 tys. losowo przebadanych osób:
  2. Oczekiwana liczba osób zdrowych (niezakażonych), u których wynik testu na przeciwciała anty-HIV będzie dodatni, wśród 100 tys. losowo przebadanych osób:
  3. Prawdopodobieństwo, że pacjent z dodatnim wynikiem testu na przeciwciała anty-HIV jest zakażony HIV:

14.4. (0–1)

Oceń, czy poniższe interpretacje przedstawionych wyników badań trojga pacjentów są prawidłowe. Zaznacz T (tak), jeśli interpretacja jest prawidłowa, albo N (nie) – jeśli jest nieprawidłowa.

1. U pacjenta 1. wynik testu na przeciwciała anty-HIV był fałszywie dodatni, o czym świadczy wykluczenie zakażenia na podstawie wyników PCR. T N
2. Wyniki testu PCR dla pacjenta 2. są niewiarygodne ze względu na dodatni wynik w próbie kontrolnej negatywnej – należy powtórzyć badanie. T N
3. Dodatkowe badanie techniką PCR potwierdziło podejrzenie, że pacjent 3. jest zakażony HIV. T N

14.5. (0–1)

Wyjaśnij, dlaczego testy wykrywające przeciwciała anty-HIV nie nadają się do diagnostyki zakażeń HIV u noworodków i niemowląt urodzonych przez matki zakażone HIV. W odpowiedzi uwzględnij spodziewany wynik testu oraz funkcjonowanie układu odpornościowego matki.

14.6. (0–1)

Oceń, czy poniższe osoby znajdują się w grupie zwiększonego ryzyka zakażenia HIV. Zaznacz T (tak), jeśli się w niej znajdują, albo N (nie) – jeśli w niej się nie znajdują.

1. Osoby przebywające w jednym pomieszczeniu z osobami zakażonymi HIV, np. w pracy lub szkole. T N
2. Osoby narażone na częste ukąszenia komarów i innych owadów odżywiających się krwią. T N
3. Sąsiedzi osób zakażonych HIV, mieszkający w tym samym domu wielorodzinnym. T N

Biomedica 2022, Poziom rozszerzony (Formuła 2015)Zadanie 25. (2 pkt)

Układ immunologiczny Zamknięte (np. testowe, prawda/fałsz)

Uzupełnij poniższy tekst tak, aby stanowił poprawną całość, podkreślając właściwy wyraz.

Immunoglobuliny występują w płynach ustrojowych wszystkich kręgowców / bezkręgowców. Wyróżniamy pięć klas immunoglobulin: IgA, IgE, IgG, IgD, IgM. Immunoglobuliny wykazują / nie wykazują powinowactwa do antygenów. Immunoglobuliny są wytwarzane przez plazmocyty będące pobudzonymi limfocytami T / B. Immunoglobuliny mogą wiązać / nie mogą wiązać toksyn(y). Immunoglobuliny odpowiadają / nie odpowiadają za indukcję immunofagocytozy. Przeciwciała należą do odpowiedzi immunologicznej nieswoistej / swoistej.

To zadanie pochodzi ze zbioru matura 2022 wydawnictwa Biomedica
Kup pełny zbiór zadań

Strony