Metody badawcze i doświadczenia

Oto lista zadań maturalnych z danego działu biologii. Aby skorzystać z dodatkowych opcji lub wybrać zadania z pozostałych działów kliknij poniżej.

Przejdź do wyszukiwarki zadań

 

Arkusz pokazowy CKE Marzec 2022, Poziom rozszerzony (Formuła 2023)Zadanie 9. (3 pkt)

Płazińce Metody badawcze i doświadczenia Podaj i uzasadnij/wyjaśnij

Zdjęcie A przedstawia bursztynkę pospolitą (Succinea putris) – niewielkiego ślimaka spotykanego w zacienionych wilgotnych zaroślach. Na zdjęciu B widoczny jest osobnik bursztynki, który ma charakterystycznie zgrubiałe czułki, świadczące o obecności w nich larw pasożytniczej przywry Leucochloridium paradoxum. Czułki tego ślimaka barwą oraz kształtem przypominają gąsienice motyli i rytmicznie pulsują. Z tego powodu zwracają na nie uwagę ptaki owadożerne, np. sikory, zięby czy muchołówki, w których diecie zwykle nie występują ślimaki. Ptaki te zjadają czułki ślimaka, przez co zarażają się pasożytem.


A

B

Bursztynki zarażają się przywrą, zjadając wraz z roślinami ptasie odchody, w których znajdują się jaja z rozwiniętym w nich pierwszym stadium larwalnym pasożyta (miracidium). W przewodzie pokarmowym ślimaka rozwijają się z nich następne stadia larwalne (sporocysty), które rozmnażają się partenogenetycznie i wytwarzają charakterystyczne worki z larwami kolejnego stadium (metacerkariami), umiejscowione w czułkach bursztynki.

Zbadano wpływ zarażenia przywrą na zachowanie ślimaków. Na wykresie przedstawiono pomiary natężenia oświetlenia w miejscach, które wybierały ślimaki mające czułki zmienione przez larwy Leucochloridium, oraz w miejscach, w których gromadziły się bursztynki bez objawów zarażenia tym pasożytem. Obserwacje osobników z obu grup trwały po 45 minut.

Na podstawie: W. Wesołowska, T. Wesołowski, Do Leucochloridium sporocysts manipulate the behaviour of their snail hosts?, „Journal of Zoology” 292, 2014;
M. Tabin, Władcy marionetek, „Wiedza i Życie” 8, 2011; www.flickr.com

9.1. (0–1)

Na podstawie przedstawionych informacji oraz wykresu opisz zmianę w zachowaniu populacji ślimaków wywołaną zarażeniem L. paradoxum.

9.2. (0–1)

Uzasadnij, że zdolność do wymuszania zmiany zachowania populacji bursztynek przez L. paradoxum stanowi adaptację do pasożytniczego trybu życia tej przywry.

9.3. (0–1)

Określ, który organizm – bursztynka czy ptak owadożerny – jest żywicielem ostatecznym L. paradoxum. Odpowiedź uzasadnij.

Arkusz pokazowy CKE Marzec 2022, Poziom rozszerzony (Formuła 2023)Zadanie 3. (5 pkt)

Metody badawcze i doświadczenia Fizjologia roślin Zamknięte (np. testowe, prawda/fałsz) Sformułuj wnioski, hipotezę lub zaplanuj doświadczenie Podaj i uzasadnij/wyjaśnij

Salvadora persica to niewielkich rozmiarów roślina drzewiasta przystosowana do wzrostu na glebach o różnym poziomie zasolenia, tolerująca nawet ekstremalne warunki zasolenia.

Poniżej przedstawiono wyniki doświadczenia uzyskane po 21 dniach hydroponicznej (bezglebowej) uprawy czterech grup siewek S. persica w zależności od stężenia NaCl w pożywce. Wszystkie siewki uprawiano w szklarni w optymalnych dla tej rośliny warunkach fotoperiodu, wilgotności powietrza i temperatury otoczenia.

Grupa siewek Stężenie NaCl w pożywce
[mmol/l]
Średnie zagęszczenie aparatów szparkowych
[liczba aparatów szparkowych na mm2]
Średnie stężenie jonów Na+ w komórkach korzeni
[mg/g suchej masy]
skórka górna skórka dolna
1. 0 82 67 2,0
2. 250 41 30 5,6
3. 500 28 23 8,8
4. 750 17 13 13,9
Na podstawie: A.K. Parida i inni, Physiological, anatomical and metabolic implications of salt tolerance in the halophyte Salvadora persica under hydroponic culture condition, „Frontiers in Plant Science” 7, 2016; T.J. Flowers, T.D. Colmer, Salinity tolerance in halophytes, „New Phytologist” 179, 2008.

3.1. (0–2)

Dokończ zdanie. Zaznacz dwie właściwe odpowiedzi spośród podanych.

Prawidłowo sformułowany problem badawczy do przedstawionego doświadczenia to:

  1. Czy zagęszczenie aparatów szparkowych u S. persica zależy od stężenia NaCl oraz strony blaszki liściowej?
  2. Czy stężenie NaCl w pożywce ma wpływ na stężenie jonów Na+ w komórkach korzeni S. persica?
  3. Czy średnie zagęszczenie aparatów szparkowych wpływa na średnie stężenie jonów Na+ w komórkach korzeni S. persica?
  4. Dlaczego stężenie NaCl wpływa na zagęszczenie aparatów szparkowych w skórce S. persica?
  5. Czy skórka górna i dolna różnią się pod względem stężenia jonów Na+?

3.2. (0–1)

Na podstawie przedstawionych wyników doświadczenia sformułuj wniosek na temat wpływu zasolenia środowiska na stężenie jonów Na+ w komórkach korzeni S. persica.

3.3. (0–1)

Określ znaczenie adaptacyjne spadku zagęszczenia aparatów szparkowych w skórce S. persica, następującego wraz ze wzrostem stężenia NaCl w środowisku.

3.4. (0–1)

Uzupełnij poniższe zdania tak, aby zawierały informacje prawdziwe. W każdym nawiasie podkreśl właściwe określenie.

Duże stężenie soli w glebie zwiększa siły osmotyczne utrzymujące wodę w roztworze glebowym. Pobieranie wody przez roślinę jest wtedy warunkowane przez (zmniejszenie / zwiększenie) potencjału wody w komórkach pobierających wodę, tak aby gradient potencjału wody pozwalał na przepływ wody z roztworu glebowego do komórki. Jest to możliwe dzięki (zmniejszeniu / zwiększeniu) stężenia jonów soli w soku komórkowym.

Matura Czerwiec 2022, Poziom rozszerzony (Formuła 2015)Zadanie 19. (3 pkt)

Metody badawcze i doświadczenia Ekologia Sformułuj wnioski, hipotezę lub zaplanuj doświadczenie Podaj/wymień Zamknięte (np. testowe, prawda/fałsz)

Soplówka bukowa (Hericium coralloides) jest grzybem z rodziny soplówkowatych (Hericiaceae). Rośnie jako saprotrof na drewnie stojących i leżących pni gatunków drzew liściastych. W Polsce spotykana jest głównie na drewnie buka (Fagus sylvatica), rzadziej na brzozie brodawkowatej (Betula pendula) i topoli osice (Populus tremula). Soplówka bukowa powoduje białą zgniliznę drewna, zwykle pni i dużych gałęzi.

Przez 10 dni hodowano w laboratorium soplówkę w warunkach różnej temperatury oraz na pożywkach o odmiennym pH, po czym zmierzono średnicę kolonii. Wyniki badań przedstawiono na poniższych wykresach.

Na podstawie: J. Piętka, Czynna ochrona zagrożonych grzybów nadrzewnych w lasach, Warszawa 2013.

19.1. (0–1)

Sformułuj problem badawczy przedstawionego doświadczenia.

19.2. (0–1)

Odczytaj z wykresów i podaj wartość optimum temperatury i optimum odczynu podłoża dla wzrostu soplówki bukowej.

Temperatura:
Odczyn podłoża:

19.3. (0–1)

Dokończ zdanie. Zaznacz odpowiedź A lub B oraz jej uzasadnienie 1., 2., albo 3.

Soplówka bukowa jest

A. autotrofem, ponieważ jako saprotrof 1. odżywia się drewnem żywych drzew liściastych.
2. przyczepia się do powierzchni kory drzew liściastych, ale nie odżywia się ich tkankami.
B. heterotrofem,
3. odżywia się tkankami martwych drzew liściastych.

Matura Maj 2022, Poziom rozszerzony (Formuła 2015)Zadanie 17. (4 pkt)

Metody badawcze i doświadczenia Inżynieria i badania genetyczne Sformułuj wnioski, hipotezę lub zaplanuj doświadczenie Zamknięte (np. testowe, prawda/fałsz)

Populacje biegusów alaskańskich w północnej części zasięgu geograficznego gatunku mają nietypowy stosunek liczebności samców i samic wynoszący 3:1, zamiast typowego – 1:1. Postawiono następującą hipotezę:

„Mały udział samic w populacjach biegusów jest spowodowany tym, że częściej padają one ofiarą sokołów wędrownych”.

W celu weryfikacji tej hipotezy zebrano pióra po biegusach upolowanych przez sokoły, a następnie wyizolowano z nich DNA i przeprowadzono PCR w celu amplifikacji fragmentów genów CHD, zlokalizowanych na chromosomach płci Z i W (odpowiednio: CHD-Z i CHD-W). Samice biegusów są heterogametyczne (ZW), a samce – homogametyczne (ZZ).

Rejony niekodujące w genach CHD-Z i CHD-W mają różną długość, co powoduje, że produkty amplifikacji rejonów niekodujących genów CHD-Z i CHD-W także różnią się długością. Elektroforetyczne rozdzielenie produktów PCR pozwoliło określić płeć ptaków, z których pochodziły zebrane pióra.

Wyniki badań przedstawiono na poniższym wykresie.

Na podstawie: S. Nebel i in., Molecular sexing of prey remains […] in a wintering population of western sandpipers, „Proceedings of the Royal Society B” 271, 2004.

17.1. (0–1)

Rozstrzygnij, czy postawiona hipoteza została przyjęta, czy – odrzucona. Odpowiedź uzasadnij, odwołując się do wyników badań przedstawionych na wykresie.

17.2. (0–1)

Który obraz żelu agarozowego odpowiada prawidłowemu wynikowi elektroforetycznego rozdzielenia powielonych fragmentów genów CHD-Z i CHD-W u samca (♂) i samicy (♀)? Zaznacz właściwą odpowiedź spośród podanych.

17.3. (0–2)

Oceń, czy poniższe stwierdzenia dotyczące techniki PCR są prawdziwe. Zaznacz P, jeśli stwierdzenie jest prawdziwe, albo F – jeśli jest fałszywe.

1. Do powielenia fragmentów genów techniką PCR należy użyć m.in. termostabilnej polimerazy DNA oraz czterech różnych deoksyrybonukleotydów. P F
2. Technika PCR umożliwia powielenie wybranych fragmentów genomowego DNA dzięki użyciu specyficznych starterów. P F
3. Rozdzielenie podwójnej helisy DNA podczas stosowania techniki PCR zachodzi dzięki ligazom DNA. P F

Matura Maj 2022, Poziom rozszerzony (Formuła 2015)Zadanie 16. (1 pkt)

Metody badawcze i doświadczenia Podaj/wymień

Wiele gatunków mew dokarmia swoje pisklęta poprzez zwracanie (regurgitację) części zjedzonego pokarmu. Głodne pisklęta, aby uzyskać pokarm od rodzica powracającego do gniazda, odruchowo uderzają w jego dziób, czym wywołują zwrot pokarmu.

Z wykorzystaniem sztucznych modeli ptasich głów postanowiono sprawdzić, jakie cechy morfologiczne głowy dorosłej mewy wyzwalają opisane zachowanie piskląt. W badaniach wzięto pod uwagę następujące cechy:

  • kształt głowy
  • kolor upierzenia
  • obecność oczu
  • kształt dzioba
  • występowanie plamki na dziobie.

Na poniższym wykresie przedstawiono wyniki doświadczenia.

Na podstawie: D. Sadava, D.M. Hillis, H.C. Heller, M.R. Berenbaum, Life – The Science of Biology, Sunderland 2014.

Określ, która z badanych cech morfologicznych głowy dorosłych mew jest najważniejsza w wywołaniu opisanego odruchu u piskląt.

Matura Lipiec 2020, Poziom rozszerzony (Formuła 2015)Zadanie 14. (2 pkt)

Metody badawcze i doświadczenia Sformułuj wnioski, hipotezę lub zaplanuj doświadczenie Podaj/wymień

Rytmy okołodobowe dotyczą procesów przebiegających w organizmie w cyklach o k. 24-godzinnych. W rytmie tym zmienia się m.in. temperatura ciała człowieka.

W celu stwierdzenia, czy na okołodobową rytmikę zmian temperatury ciała człowieka wpływają zmieniające się czynniki zewnętrzne, przeprowadzono badanie. W czasie 24 godzin dokonywano pomiarów temperatury ciała osób w dwóch grupach:

  • grupa I – osoby, które w ciągu dnia były wystawione na działanie światła, wykazywały zwiększoną aktywność fizyczną, spożywały posiłki o zwykłej porze, natomiast w ciągu nocy spały w zaciemnionym pomieszczeniu.
  • grupa II – osoby, które od godziny 4 rano przez kolejne 24 godziny przebywały w warunkach stałego oświetlenia, ich aktywność fizyczna pozostawała na tym samym poziomie przez cały czas trwania pomiarów oraz przyjmowały równe porcje pokarmu w stałych, wymuszonych odstępach czasowych.

Na wykresie przedstawiono wyniki przeprowadzonych pomiarów temperatury.

Na podstawie: J. Waterhouse, Y. Fukuda, T. Morita, Daily rhythms of the sleep-wake cycle, „ Journal of Physiological Anthropology”, 31(1): 5, 2012.

14.1. (0–1)

Określ, które zmienne w przedstawionym badaniu to zmienne zależne, a które – niezależne. Wstaw znak „X” w odpowiednie komórki tabeli.

Zmienna zależna niezależna
oświetlenie
aktywność fizyczna
pora dnia
temperatura ciała

14.2. (0–1)

Wybierz i zaznacz stwierdzenie, które jest poprawnym wnioskiem sformułowanym na podstawie wyników opisanego badania.

  1. Rytm zmian temperatury ciała osób z grupy II nieznacznie różnił się od rytmu zmian występującego u osób przebywających w naturalnych zmiennych warunkach środowiska.
  2. Okołodobowa rytmika zmian temperatury ciała jest sterowana przez ośrodek termoregulacji znajdujący się w międzymózgowiu.
  3. Na okołodobowy rytm zmian temperatury ciała człowieka wpływają zarówno czynniki wewnętrzne, jak i czynniki zewnętrzne.
  4. Temperatura ciała osób z grupy I waha się między temperaturą minimalną wynoszącą 36,5°C (około trzy godziny przed obudzeniem się) a temperaturą maksymalną wynoszącą 37,4°C w godzinach 17.00–18.00.

Matura Lipiec 2020, Poziom rozszerzony (Formuła 2015)Zadanie 9. (1 pkt)

Metody badawcze i doświadczenia Sformułuj wnioski, hipotezę lub zaplanuj doświadczenie

Na schemacie przedstawiono początek i wynik doświadczenia, którego celem było wykazanie, że korzeń grochu reaguje na działanie bodźca kierunkowego – dostępności wody w glebie.

Na podstawie: http://scienceandtechnology-manojsir.blogspot.com

Zaplanuj i opisz próbę kontrolną do doświadczenia przedstawionego na schemacie.

Matura Lipiec 2020, Poziom rozszerzony (Formuła 2015)Zadanie 6. (2 pkt)

Metody badawcze i doświadczenia Sformułuj wnioski, hipotezę lub zaplanuj doświadczenie

Bezwodny chlorek kobaltu ma barwę niebieską, natomiast po związaniu cząsteczek wody przyjmuje zabarwienie różowe.

Uczniowie uprawiali w szkolnym ogrodzie trzy gatunki roślin: pomidory, fasolę i nasturcję. Byli ciekawi, którą z grządek należy najczęściej podlewać.

Przygotowali więc po 3 doniczki z roślinami: pomidora, fasoli oraz nasturcji. Następnie na górnej i dolnej powierzchni jednego liścia każdej z roślin umieścili krążki wysuszonej bibuły nasyconej chlorkiem kobaltu i przykryli je szkiełkami przytrzymywanymi przez zaciski tak, aby nie uszkodzić liścia.

Czas potrzebny do zmiany zabarwienia papierków na różowy u wszystkich roślin, zarówno na dolnej, jak i na górnej powierzchni liści, uczniowie zmierzyli za pomocą stopera, a następnie obliczyli odpowiednie wartości średnie, a wyniki podali w sekundach.

Na podstawie: http://www.biologydiscussion.com/experiments/top-10-experiments-on-plants-with- diagram/56651

6.1. (0–1)

Sformułuj problem badawczy przedstawionego doświadczenia. W odpowiedzi uwzględnij badany proces oraz obydwie zmienne niezależne.

6.2. (0–1)

Zaprojektuj tabelę, w której będzie można zestawić wyniki przedstawionego doświadczenia. Uwzględnij nagłówki kolumn i objaśnienia wierszy tabeli.

Matura Lipiec 2020, Poziom rozszerzony (Formuła 2015)Zadanie 1. (5 pkt)

Tkanki roślinne Fizjologia roślin Metody badawcze i doświadczenia Zamknięte (np. testowe, prawda/fałsz) Podaj i uzasadnij/wyjaśnij

Pierwotnym źródłem cukrów u roślin jest proces asymilacji dwutlenku węgla w chloroplastach. Węgiel eksportowany jest z chloroplastów głównie w postaci triozofosforanów, choć w wielu przypadkach do cytoplazmy jest uwalniana również glukoza, powstająca w wyniku hydrolizy skrobi okresowo gromadzonej w tych organellach. W warunkach zakłócenia eksportu produktów fotosyntezy skrobia gromadzi się w chloroplastach liści, co jest dobrym wskaźnikiem tego zaburzenia.

Poniżej przedstawiono doświadczenie, którego celem było sprawdzenie wpływu deficytu magnezu na zaburzenia eksportu cukrów w liściach rzodkiewnika pospolitego.

Hipoteza:
Pierwszym z badanych objawów niedoboru magnezu u rzodkiewnika pospolitego jest zaburzenie eksportu cukrów z liści.

Przebieg doświadczenia:
Przez 21 dni prowadzono uprawę hydroponiczną sadzonek rzodkiewnika pospolitego, stosując różne pożywki:

  • połowę roślin zasilano pożywką pełną – próba A;
  • drugą połowę roślin zasilano pożywką bez soli magnezu – próba B.

Rośliny oświetlano przez 12 h na dobę. Przez cały czas trwania doświadczenia obserwowano zabarwienie liści oraz ważono rośliny. Natomiast 14. dnia trwania doświadczenia wybrane rośliny barwiono płynem Lugola.

Wyniki doświadczenia:

  1. Barwienie płynem Lugola – przykładowe rośliny po 14 dniach uprawy przedstawiono na zdjęciu poniżej;
  2. Barwa liści roślin – od 15. dnia wystąpiło stopniowe żółknięcie liści roślin w próbie B;
  3. Masa roślin – od 16. dnia odnotowywano, że rośliny z próby B miały niższą świeżą masę niż rośliny w próbie A.
Na podstawie: Ch. Hermans, N. Verbruggen, Physiological characterization of (…) Arabidopsis thaliana, „Journal of Experimental Botany”, Vol. 56, 2005.

1.1. (0–1)

Określ, która próba roślin – A czy B – stanowiła próbę kontrolną w opisanym doświadczeniu. Odpowiedź uzasadnij, odwołując się do znaczenia tej próby w sprawdzeniu postawionej hipotezy.

1.2. (0–1)

Oceń, podkreślając TAK lub NIE, czy wyniki doświadczenia potwierdziły postawioną hipotezę. Wyjaśnij uzyskane wyniki.

Potwierdzenie hipotezy: TAK / NIE

Wyjaśnienie:

1.3. (0–1)

Wykaż związek między stopniowym żółknięciem badanych roślin a ich uprawą na pożywce bez soli magnezu.

1.4. (0–1)

Wyjaśnij, dlaczego rośliny zasilane pożywką bez soli magnezu miały niższą świeżą masę niż rośliny zasilane pożywką pełną.

1.5. (0–1)

Spośród wymienionych elementów budowy rośliny wybierz i podkreśl wszystkie te, które biorą bezpośredni udział w transporcie węglowodanów z komórek miękiszu asymilacyjnego liści rzodkiewnika do komórek korzeni tej rośliny.

komórki przyrurkowe
naczynia
cewki
rurki sitowe
włókna drzewne

Matura Czerwiec 2021, Poziom rozszerzony (Formuła 2015)Zadanie 19. (2 pkt)

Metody badawcze i doświadczenia Ekologia Zamknięte (np. testowe, prawda/fałsz) Podaj i uzasadnij/wyjaśnij

Podczas badań mokradeł występujących u ujścia rzeki do morza zaobserwowano, że trawa spartyna (Spartina patens) jest dominującym gatunkiem na mokradłach słonowodnych, a pałka wąskolistna (Typha angustifolia) – na mokradłach słodkowodnych. Przygotowano eksperyment terenowy, w którym posadzono spartynę oraz pałkę wąskolistną na poletkach doświadczalnych przygotowanych w dwóch wariantach:

  • na mokradłach słonowodnych i na mokradłach słodkowodnych w obecności innych gatunków roślin, z którymi naturalnie występują,
  • na mokradłach słonowodnych i na mokradłach słodkowodnych bez obecności innych gatunków.

Po upływie dwóch sezonów wegetacyjnych zmierzono biomasę osobników spartyny i pałki wąskolistnej na wszystkich poletkach. Wyniki eksperymentu przedstawiono w tabeli.

Średnia biomasa
[g/dm2]
spartyna pałka wąskolistna
mokradła słonowodne mokradła słodkowodne mokradła słonowodne mokradła słodkowodne
W obecności
innych gatunków roślin
8 3 0 18
Bez obecności
innych gatunków roślin
10 20 0 33
Na podstawie: Biologia, pod red. N.A. Campbella, Poznań 2012;
C.M. Crain i wsp., Physical and biotic drivers of plant distribution accross estuarine salinity gradients, „Ecology” 85(9), 2004.

19.1. (0–1)

Oceń, czy na podstawie przedstawionych wyników eksperymentu można sformułować poniższe wnioski. Zaznacz T (tak), jeśli taki wniosek można sformułować, albo N (nie) – jeśli nie można go sformułować.

1. Pałka wąskolistna ma szerszy zakres tolerancji na zasolenie wód niż spartyna. T N
2. Przy braku konkurencji siedliskiem optymalnym dla spartyny są mokradła słonowodne. T N
3. Mniejszy udział spartyny w zbiorowiskach mokradeł słodkowodnych jest wynikiem jej konkurencyjnego wypierania. T N

19.2. (0–1)

Określ, czy nieobecność pałki wąskolistnej w zbiorowiskach mokradeł słonowodnych jest wynikiem konkurencji międzygatunkowej, czy – zasolenia wody. Odpowiedź uzasadnij, odnosząc się do wyników eksperymentu.

Matura Czerwiec 2021, Poziom rozszerzony (Formuła 2015)Zadanie 5. (4 pkt)

Fizjologia roślin Metody badawcze i doświadczenia Sformułuj wnioski, hipotezę lub zaplanuj doświadczenie Zamknięte (np. testowe, prawda/fałsz) Podaj i uzasadnij/wyjaśnij

Liście tej samej rośliny mogą w zależności od warunków oświetlenia różnić się grubością blaszki liściowej, stopniem jej unerwienia i zagęszczeniem szparek. Rozmiary i zagęszczenie szparek w skórce liścia przy danej intensywności światła umożliwiają wymianę gazową na takim poziomie, że asymilacja CO2 ulega wysyceniu, tzn. dalsze zwiększanie wymiany gazowej nie zwiększa intensywności fotosyntezy.

W tabeli przedstawiono wyniki obserwacji budowy liści niektórych drzew rosnących w różnych warunkach oświetlenia: N – nasłonecznienia i Z – zacienienia.

Gatunek Warunki oświetlenia Grubość blaszki liściowej
[μm]
Stopień unerwienia
[mm / mm2]
Zagęszczenie szparek
[liczba / mm2]
wiąz pospolity
(Ulmus minor)
N 194 17,2 800
Z 176 10,5 450
olsza czarna
(Alnus glutinosa)
N 177 8,1 608
Z 146 3,6 425
grab pospolity
(Carpinus betulus)
N 183 9,8 365
Z 93 6,9 170
klon jawor
(Acer pseudoplatanus)
N 178 7,8 860
Z 97 5,6 215
Na podstawie: Z. Hejnowicz, Anatomia i histogeneza roślin naczyniowych. Organy wegetatywne, Warszawa 2012.

5.1. (0–1)

Na podstawie przedstawionych wyników obserwacji sformułuj wniosek dotyczący wpływu nasłonecznienia na grubość blaszki liściowej u badanych gatunków drzew.

5.2. (0–1)

Określ, które stwierdzenia dotyczące budowy liści przedstawionych gatunków drzew są prawdziwe. Zaznacz P, jeśli stwierdzenie jest prawdziwe, albo F – jeśli jest fałszywe.

1. Stopień unerwienia w liściu zależy zarówno od gatunku rośliny, jak i od warunków oświetlenia, w których ona rośnie. P F
2. Największe zagęszczenie szparek w obu warunkach oświetlenia zaobserwowano u klonu jawora. P F
3. Największy stosunek stopnia unerwienia liści w warunkach nasłonecznienia do stopnia unerwienia liści w warunkach zacienienia zaobserwowano u wiązu pospolitego. P F

5.3. (0–2)

Wyjaśnij, dlaczego liście drzew rosnących w miejscach nasłonecznionych mają w stosunku do liści z miejsc zacienionych większe zagęszczenie aparatów szparkowych i bardziej rozbudowaną nerwację liści. W odpowiedzi uwzględnij substraty fotosyntezy.

Matura Czerwiec 2021, Poziom rozszerzony (Formuła 2015)Zadanie 2. (4 pkt)

Budowa i funkcje komórki Metody badawcze i doświadczenia Sformułuj wnioski, hipotezę lub zaplanuj doświadczenie Podaj i uzasadnij/wyjaśnij

Peroksysomy to pęcherzyki otoczone pojedynczą błoną biologiczną, występujące w komórkach roślinnych i zwierzęcych. Od innych struktur błoniastych w komórce odróżnia je m.in. obecność enzymu – katalazy. Zawierają one także różne enzymy z grupy oksydoreduktaz. Nazwa peroksysomów pochodzi od angielskiej nazwy nadtlenku wodoru – hydrogen peroxide (H2O2), który jest toksyczny dla komórek, a powstaje w peroksysomach w procesach utleniania i jest rozkładany przez katalazę. Szczególnie duże i liczne peroksysomy występują np. w komórkach wątrobowych (hepatocytach) i w bulwach ziemniaka.

Uczniowie zaplanowali doświadczenie, którego celem było określenie optymalnej temperatury dla działania katalazy występującej w komórkach bulwy ziemniaka. Przygotowali sok z bulwy ziemniaka, który rozdzielili w równej objętości (po 5 ml) do 30 probówek, umieszczonych po sześć w termostatach ustawionych na temperaturę: 0, 10, 20, 30 i 40°C.

Na podstawie: Biologia, pod red. N.A. Campbella, Poznań 2012.

2.1. (0–2)

Zaplanuj dalszy ciąg tego doświadczenia tak, aby umożliwił określenie optymalnej temperatury dla działania katalazy.

Nazwa lub wzór związku chemicznego, którego należy użyć:

Sposób zastosowania tego związku chemicznego:

Oczekiwany jakościowy wynik reakcji:

Metoda ilościowego określenia wyniku reakcji:

2.2. (0–1)

Opisz próbę kontrolną, która pozwoli wykazać, że rozkład H2O2 w tym doświadczeniu miał charakter enzymatyczny.

2.3. (0–1)

Wyjaśnij, jakie znaczenie dla funkcjonowania komórki ma obecność katalazy w peroksysomach – wyodrębnionych przedziałach komórkowych, w których powstaje nadtlenek wodoru.

Informator CKE, Poziom rozszerzony (Formuła 2023)Zadanie 18. (5 pkt)

Ewolucjonizm i historia życia na ziemi Metody badawcze i doświadczenia Zamknięte (np. testowe, prawda/fałsz) Podaj i uzasadnij/wyjaśnij

Gupiki to niewielkie ryby, które w naturze żyją m.in. na Trynidadzie, w małych zbiornikach wodnych położonych wzdłuż górskich strumieni. Wodospady tworzone przez strumienie pokonujące progi skalne stanowią jednostronną barierę – ryby żyjące w zbiorniku poniżej wodospadu nie mogą przepłynąć w górę potoku, ale ryby ze zbiornika ponad wodospadem niekiedy dostają się ze spadającą wodą do dolnego zbiornika. Samce gupików są mniejsze od samic, ale znacznie bardziej kolorowe. Samica częściej wybiera barwniejszego samca jako partnera do rozmnażania.

Badacze porównywali ubarwienie samców gupików bytujących w dwóch zbiornikach strumienia 1. – w zbiorniku poniżej wodospadu, w którym występowały drapieżniki, oraz w zbiorniku powyżej wodospadu, w którym drapieżników nie było. Zauważyli, że samce gupików ze zbiornika powyżej wodospadu są intensywniej ubarwione od żyjących w zbiorniku poniżej wodospadu. Wyniki obserwacji przedstawia rysunek poniżej.

Badacze wysunęli dwie hipotezy wyjaśniające te różnice.

Hipoteza I: W sytuacji nieobecności drapieżników wyższe dostosowanie mają intensywniej ubarwione samce (ponieważ są częściej wybierane przez samice).
Hipoteza II: W razie presji drapieżników wyższe dostosowanie mają samce mniej widoczne, o mniej intensywnym ubarwieniu (ponieważ są rzadziej zjadane).

Aby sprawdzić te hipotezy, badacze przenosili gupiki i drapieżne ryby ze zbiorników strumienia 1. do odpowiednich zbiorników bezrybnego strumienia 2., a następnie obserwowali zmiany częstości fenotypów samców przez kilkadziesiąt pokoleń. Potwierdzili obie hipotezy: wykazali, że w naturze intensywność ubarwienia samców jest ewolucyjnym kompromisem między przeciwstawnymi kierunkami doboru.

Na podstawie: http://www.guppyevolution.org/science/

18.1. (0–3)

1. Przedstaw plan opisanego eksperymentu – wpisz w tabelę znak „+” oznaczający przeniesienie ryb ze zbiorników strumienia 1. do zbiorników strumienia 2.

Docelowy zbiornik w bezrybnym strumieniu 2. Przenoszone ryby ze strumienia 1.
gupiki z górnego zbiornika (bez drapieżnych ryb) gupiki z dolnego zbiornika (z drapieżnymi rybami) drapieżne ryby z dolnego zbiornika
górny
dolny

2. Podaj populacje gupików (numer strumienia i położenie zbiornika), które porównywano w celu zweryfikowania obu hipotez. Określ spodziewane wyniki, odnosząc się do zmiany fenotypów samców.

Populacje gupików porównywane w celu sprawdzenia hipotezy I:
Wynik potwierdzający hipotezę I:

Populacje gupików porównywane w celu sprawdzenia hipotezy II:
Wynik potwierdzający hipotezę II:

18.2. (0–1)

Określ, czy w opisanym eksperymencie działa dobór naturalny czy dobór sztuczny. Odpowiedź uzasadnij.

18.3. (0–1)

Uzupełnij poniższe zdania tak, aby powstał poprawny opis warunków przeprowadzenia opisanego eksperymentu. W każdym nawiasie podkreśl właściwe określenie.

W celu poprawnego przeprowadzenia opisanego eksperymentu należy przenieść z jednego zbiornika do drugiego (liczną grupę gupików / jedną ich parę). To przy zbyt (niskiej / wysokiej) liczebności grupy założycielskiej nowej populacji nasila się (dryf genetyczny / dobór naturalny), który mógłby zniekształcić wynik doświadczenia.

Informator CKE, Poziom rozszerzony (Formuła 2023)Zadanie 14. (8 pkt)

Układ immunologiczny Choroby człowieka Ekspresja informacji genetycznej Metody badawcze i doświadczenia Uzupełnij/narysuj wykres, schemat lub tabelę Zamknięte (np. testowe, prawda/fałsz) Podaj i uzasadnij/wyjaśnij

Współcześnie stosuje się dwie podstawowe metody wykrywania zakażeń HIV. Rutynowe badanie polega na wykrywaniu przeciwciał anty-HIV w surowicy pacjenta. W przypadku tej metody czułość badania, czyli prawdopodobieństwo otrzymania wyniku dodatniego u osoby chorej, tzn. wykrycia zakażenia, wynosi 100%, ale wynik dodatni otrzymuje się także dla 0,5% zdrowych osób – specyficzność wynosi 99,5%. Dlatego postawienie diagnozy zakażenia HIV wymaga potwierdzenia dodatkowym badaniem za pomocą metody PCR, wykrywającym gen odwrotnej transkryptazy wbudowany w genom gospodarza. Ta metoda jest teoretycznie bezbłędna pod warunkiem utrzymywania wysokich standardów pracy laboratoryjnej. Odpowiednie próby kontrolne służą sprawdzeniu, czy:

  • polimeraza DNA nie utraciła aktywności podczas przechowywania (kontrola pozytywna),
  • wszystkie odczynniki są wolne od wirusowego materiału genetycznego (kontrola negatywna).

Dla trzech pacjentów uzyskano dodatni wynik testu na obecność przeciwciał anty-HIV. Z tego powodu lekarz zlecił dodatkowe badanie z wykorzystaniem metody PCR, którego wyniki podsumowano w poniższej tabeli.

Próba
badawcza kontrolna pozytywna kontrolna negatywna
Pacjent 1. +
Pacjent 2. + + +
Pacjent 3. + +
Na podstawie: GenBank sekwencja nr KR861191.1;
M. Fearon, The Laboratory Diagnosis of HIV Infections, „Can J Dis Med Microbiol” 16, 2005, s. 26–30;
D.S Boyle i inni, Rapid Detection of HIV-1 Proviral DNA for Early Infant Diagnosis Using Recombinase Polymerase Amplification, „mBio” 4, 2013, e00135–13;
S. Koblavi-Dème i inni, Sensitivity and Specificity of Human Immunodeficiency Virus Rapid Serologic Assays and Testing Algorithms in an Antenatal Clinic in Abidjan, Ivory Coast, „J Clin Microbiol” 39, 2001, s. 1808–1812.

14.1. (0–2)

Zaprojektuj doświadczenie PCR wykrywające DNA HIV wbudowane w genom gospodarza. Dla każdej z prób – badawczej, kontrolnej pozytywnej i kontrolnej negatywnej – wybierz wszystkie właściwe składniki mieszaniny reakcyjnej. Wpisz w tabelę znak „+”, jeśli składnik należy dodać do próby, albo znak „–”, jeśli ten składnik należy pominąć.

Próba
badawcza kontrolna pozytywna kontrolna negatywna
DNA genomowy wyizolowany od pacjenta
DNA genomowy wyizolowany z linii komórkowej zakażonej HIV
para specyficznych starterów
bufor zapewniający optymalne pH i stężenie jonów Mg2+
termostabilna polimeraza DNA
mieszanina deoksyrybonukleotydów

14.2. (0–1)

Wybierz spośród A–D i zaznacz prawidłowe sekwencje starterów polF1 i polR1, wykorzystywanych w teście diagnostycznym HIV, przyłączających się do zaznaczonych fragmentów poniższej sekwencji genu odwrotnej transkryptazy wirusa HIV, wbudowanej w genom gospodarza.

  1. polF1 5′ CCCTACAATCCCCAAAGTCAAGGAGTAGTAGAA 3′
    polR1 5′ CTCTGGAAAGGTGAAGGGGCAGTAGTAATACA 3′
  2. polF1 5′ TTCTACTACTCCTTGACTTTGGGGATTGTAGGG 3′
    polR1 5′ TGTATTACTACTGCCCCTTCACCTTTCCAGAG 3′
  3. polF1 5′ CCCTACAATCCCCAAAGTCAAGGAGTAGTAGAA 3′
    polR1 5′ TGTATTACTACTGCCCCTTCACCTTTCCAGAG 3′
  4. polF1 5′ TTCTACTACTCCTTGACTTTGGGGATTGTAGGG 3′
    polR1 5′ CTCTGGAAAGGTGAAGGGGCAGTAGTAATACA 3′

14.3. (0–2)

Podpunkt anulowany przez CKE

Przed zabiegiem chirurgicznym pacjentowi wykonano testy na nosicielstwo wirusa HIV wykrywające przeciwciała anty-HIV. Wynik wyszedł dodatni. Pacjent nie znajduje się w żadnej z grup ryzyka zakażenia HIV. Według oficjalnych danych częstość występowania zakażenia HIV w Polsce wynosi ok. 40 osób na 100 tys.

Oblicz prawdopodobieństwo, że pacjent jest zakażony HIV, z uwzględnieniem czułości i specyficzności testu na przeciwciała anty-HIV. Zapisz obliczenia w wyznaczonych miejscach 1.–3.

  1. Oczekiwana liczba osób zakażonych HIV, u których wynik testu na przeciwciała anty-HIV będzie dodatni, wśród 100 tys. losowo przebadanych osób:
  2. Oczekiwana liczba osób zdrowych (niezakażonych), u których wynik testu na przeciwciała anty-HIV będzie dodatni, wśród 100 tys. losowo przebadanych osób:
  3. Prawdopodobieństwo, że pacjent z dodatnim wynikiem testu na przeciwciała anty-HIV jest zakażony HIV:

14.4. (0–1)

Oceń, czy poniższe interpretacje przedstawionych wyników badań trojga pacjentów są prawidłowe. Zaznacz T (tak), jeśli interpretacja jest prawidłowa, albo N (nie) – jeśli jest nieprawidłowa.

1. U pacjenta 1. wynik testu na przeciwciała anty-HIV był fałszywie dodatni, o czym świadczy wykluczenie zakażenia na podstawie wyników PCR. T N
2. Wyniki testu PCR dla pacjenta 2. są niewiarygodne ze względu na dodatni wynik w próbie kontrolnej negatywnej – należy powtórzyć badanie. T N
3. Dodatkowe badanie techniką PCR potwierdziło podejrzenie, że pacjent 3. jest zakażony HIV. T N

14.5. (0–1)

Wyjaśnij, dlaczego testy wykrywające przeciwciała anty-HIV nie nadają się do diagnostyki zakażeń HIV u noworodków i niemowląt urodzonych przez matki zakażone HIV. W odpowiedzi uwzględnij spodziewany wynik testu oraz funkcjonowanie układu odpornościowego matki.

14.6. (0–1)

Oceń, czy poniższe osoby znajdują się w grupie zwiększonego ryzyka zakażenia HIV. Zaznacz T (tak), jeśli się w niej znajdują, albo N (nie) – jeśli w niej się nie znajdują.

1. Osoby przebywające w jednym pomieszczeniu z osobami zakażonymi HIV, np. w pracy lub szkole. T N
2. Osoby narażone na częste ukąszenia komarów i innych owadów odżywiających się krwią. T N
3. Sąsiedzi osób zakażonych HIV, mieszkający w tym samym domu wielorodzinnym. T N

Informator CKE, Poziom rozszerzony (Formuła 2023)Zadanie 11. (3 pkt)

Ewolucjonizm i historia życia na ziemi Metody badawcze i doświadczenia Zamknięte (np. testowe, prawda/fałsz)
Zadanie anulowane przez CKE jako niezgodne z wymaganiami egzaminacyjnymi

Białko prionowe (PrP) w neuronach ssaków może występować w dwóch formach przestrzennych: sfałdowanej prawidłowo oraz sfałdowanej nieprawidłowo. Nie poznano dotąd funkcji formy prawidłowej, natomiast forma nieprawidłowa jest przyczyną chorób prionowych, np. choroby Creutzfeldta-Jakoba.

W celu określenia funkcji białka PrP w neuronie hodowano myszy o genotypie dzikim (PrP+/+) oraz myszy z nieaktywnymi obiema kopiami genu kodującego badane białko (PrP-/-). Z myszy wyizolowano neurony i zmierzono czas trwania depolaryzacji (A) i repolaryzacji (B). Wyniki eksperymentu przedstawiono na poniższym wykresie.

Informacja do wykresu

Średni czas depolaryzacji i repolaryzacji wraz z odchyleniem standardowym.

W plemieniu Fore z Papui-Nowej Gwinei dawniej występowała choroba kuru, będąca odmianą choroby Creutzfeldta-Jakoba. Choroba rozprzestrzeniała się, ponieważ w tym plemieniu praktykowano rytualny kanibalizm zmarłych. Po zaprzestaniu tych praktyk ustały przypadki nowych zachorowań. U części członków tego plemienia wykryto allel genu kodującego PrP − całkowicie eliminujący ryzyko zachorowania na chorobę Creutzfeldta-Jakoba. Tego allelu nie znaleziono dotychczas w innych ludzkich populacjach.

Na podstawie: H. Khosravani i inni, Prion protein attenuates excitotoxicity by inhibiting NMDA receptors, „Journal of Cell Biology” 181, 2008, s. 551–565;
E.A. Asante i inni, A naturally occurring variant of the human prion protein completely prevents prion disease, „Nature” 522, 2015, s. 478–48

11.1. (0–2)

Uzupełnij poniższe zdania tak, aby powstał poprawny wniosek dotyczący wpływu białka PrP na czas depolaryzacji i repolaryzacji neuronu. W każdym nawiasie podkreśl właściwe określenie.

Białko PrP (skraca / wydłuża) czas (depolaryzacji / repolaryzacji) błony neuronu, ponieważ typowe wyniki pomiarów w próbie badawczej były (krótsze / dłuższe) od typowych wyników w próbie kontrolnej. Natomiast ustalenie, czy białko PrP skraca, czy – wydłuża czas (depolaryzacji / repolaryzacji), nie jest możliwe, ponieważ wyniki pomiarów w próbach badawczej i kontrolnej w znacznym stopniu się pokrywały.

11.2. (0–1)

Oceń, czy poniższe informacje dotyczące choroby kuru są prawdziwe. Zaznacz P, jeśli informacja jest prawdziwa, albo F – jeśli jest fałszywa.

1. Korzystne mutacje chroniące przed kuru powstały w DNA w wyniku rytualnego kanibalizmu osób zmarłych na tę chorobę. P F
2. Allel chroniący przed zachorowaniem na kuru prawdopodobnie zwiększył swoją częstość wśród ludu Fore dzięki doborowi naturalnemu. P F
3. Wskutek zaprzestania kanibalizmu wśród Fore allel chroniący przed kuru stracił znaczenie adaptacyjne, ale może się utrzymać dzięki dryfowi genetycznemu. P F

Biomedica 2022, Poziom rozszerzony (Formuła 2015)Zadanie 16. (3 pkt)

Enzymy Układ pokarmowy i żywienie Metody badawcze i doświadczenia Podaj/wymień

Studenci biologii przeprowadzili pewien eksperyment.

Jak pokazano na powyższym schemacie, do probówek oznaczonych numerami od 1 do 3 dodawano nieznany enzym w celu jego identyfikacji. W każdej z probówek znajdowała się ta sama ilość białka.
Probówki różniły się wartością pH:
1 ⟶ pH = 1,5
2 ⟶ pH = 7
3 ⟶ pH = 9

Po 10 minutach od dodania tej samej ilości ENZYMU TRAWIENNEGO wykazano, że białko uległo strawieniu tylko w probówce nr 1.

16.1. (0–1)

Podaj nazwę enzymu trawiennego dodanego do probówek.

16.2. (0–1)

Podaj problem badawczy do przeprowadzonego eksperymentu.

16.3. (0–1)

Podaj, dlaczego białko uległo strawieniu tylko w probówce nr 1.

To zadanie pochodzi ze zbioru matura 2022 wydawnictwa Biomedica
Kup pełny zbiór zadań

Informator CKE, Poziom rozszerzony (Formuła 2023)Zadanie 6. (4 pkt)

Protisty Metody badawcze i doświadczenia Sformułuj wnioski, hipotezę lub zaplanuj doświadczenie Podaj i uzasadnij/wyjaśnij

Zielenica Scenedesmus subspicatus może być jednokomórkowa lub tworzyć 2-, 4- lub 8-komórkowe kolonie. Postawiono hipotezę, że forma morfologiczna glonu wynika z presji roślinożercy.

Aby przetestować tę hipotezę, przeprowadzono następujący eksperyment. Dodano do wody sole mineralne i rozpoczęto hodowlę S. subspicatus w warunkach sztucznego oświetlenia i stałej temperatury równej 20°C. Po sześciu dniach populacja składała się prawie wyłącznie z formy jednokomórkowej o rozmiarach 6–8 × 4–5 μm w zagęszczeniu około 20 tys. komórek/ml. Na tym etapie hodowlę podzielono na cztery części i umieszczono w osobnych naczyniach o objętości 100 ml. Do dwóch z nich dodano po jednym osobniku Daphnia magna – skorupiaka o wielkości około 3 mm, który w warunkach naturalnych żywi się fitoplanktonem. Pozostałe warunki hodowli nie uległy zmianie. We wszystkich czterech próbach codziennie sprawdzano gęstość hodowli oraz udział poszczególnych form morfologicznych.

Wyniki eksperymentu przedstawiono na poniższych wykresach w postaci średnich oraz zakresu zmienności w dwóch powtórzeniach.

Na podstawie: D.O Hessen, E. Van Donk, Morphological changes in Scenedesmus induced by substances released from Daphnia, „Archiv für Hydrobiologie” 127, 1993, s. 129–129.

6.1. (0–1)

Sformułuj wniosek na podstawie przedstawionych wyników doświadczenia.

6.2. (0–1)

Wyjaśnij, dlaczego prowadzono hodowlę S. subspicatus także bez obecności D. magna. W odpowiedzi uwzględnij znaczenie tej próby w interpretacji wyników doświadczenia.

6.3. (0–2)

Wyjaśnij, dlaczego dla utrzymania hodowli S. subspicatus konieczne jest:

  1. włączenie oświetlenia,
  2. dodanie do wody soli mineralnych.

Informator CKE, Poziom rozszerzony (Formuła 2023)Zadanie 3. (2 pkt)

Budowa i funkcje komórki Metody badawcze i doświadczenia Zamknięte (np. testowe, prawda/fałsz)

Paklitaksel to związek chemiczny wyizolowany z kory cisa krótkolistnego (Taxus brevifolia). Stosuje się go w leczeniu m.in. raka sutka, jajnika i płuc. Działanie paklitakselu polega na stabilizacji mikrotubul i zahamowaniu ich depolimeryzacji, co uniemożliwia ich skracanie. Apigenina jest flawonem występującym m.in. w kwiatach rumianku, pietruszce i selerze.

Poniżej przedstawiono wykres ilustrujący odsetek komórek nowotworowych, które pozostały żywe po 24 godzinach od podania paklitakselu (Pak), apigeniny (Api) lub obu związków razem (Pak i Api).

Słupki błędów wskazują odchylenie standardowe, a symbol ** oznacza, że wartość średnia dla próby badawczej różniła się istotnie statystycznie od wartości średniej uzyskanej w próbie kontrolnej (p < 0,01).

Na podstawie: Y. Xu i inni, Synergistic Effects of Apigenin and Paclitaxel on Apoptosis of Cancer Cells, „PLoS ONE" 6(12), 2011, s. 1-12.

3.1. (0–1)

Dokończ zdanie. Zaznacz odpowiedź A, B albo C oraz jej uzasadnienie 1., 2. albo 3.

Paklitaksel jest przyczyną zatrzymania cyklu komórkowego w fazie

A. S, ponieważ 1. chromatydy siostrzane nie mogą być rozdzielone.
B. G2, 2. hamuje on syntezę DNA.
C. M, 3. powoduje on wydłużanie mikrotubul.

3.2. (0–1)

Uzupełnij poniższe zdania tak, aby powstał poprawny opis interpretacji przedstawionego wykresu. W każdym nawiasie podkreśl właściwe określenie.

Paklitaksel i apigenina podane razem powodują, że po 24 godzinach przeżywa średnio około (50% / 80%) komórek. Na podstawie wykresu zamieszczonego we wprowadzeniu do zadania można stwierdzić, że podanie paklitakselu i apigeniny (razem / oddzielnie) będzie – średnio rzecz biorąc – skuteczniejsze w terapii raka niż podawanie ich (razem / oddzielnie).

Informator CKE, Poziom rozszerzony (Formuła 2023)Zadanie 2. (4 pkt)

Oddychanie komórkowe Genetyka - pozostałe Metody badawcze i doświadczenia Zamknięte (np. testowe, prawda/fałsz) Podaj i uzasadnij/wyjaśnij

Organizmy modelowe są używane m.in. do badania zależności między genami, szlakami sygnałowymi i metabolizmem. Homeostaza lipidów i glukozy jest w podobny sposób kontrolowana u bezkręgowców i ssaków – za pomocą ścieżki sygnałowej uruchamianej przez insulinę. W celu określenia, czy dieta wysokotłuszczowa wpływa na metabolizm węglowodanów, lipidów i białek, przeprowadzono badania z wykorzystaniem identycznych genetycznie samic szczepu w1118 wywilżny karłowatej (Drosophila melanogaster) podzielonych na dwie grupy:

grupa I – osobniki hodowane na pożywce standardowej, wykorzystywanej w laboratoriach do hodowli wywilżny i zapewniającej jej wszystkie niezbędne do normalnego rozwoju składniki odżywcze;
grupa II – osobniki hodowane na pożywce standardowej, do której dodano oleju kokosowego (pożywka o dużej zawartości tłuszczów nasyconych).

Po tygodniu oznaczono zawartość określonych metabolitów u osobników należących do każdej z grup.

Na poniższych wykresach przedstawiono zawartość względną kwasów tłuszczowych (A) oraz zawartość względną wybranych metabolitów (B) w ciele much karmionych pożywką o wysokiej zawartości tłuszczów nasyconych, w porównaniu z zawartością tych związków w 1 mg masy ciała much karmionych pożywką standardową.

Informacja do wykresu
■ pożywka standardowa
□ pożywka o wysokiej zawartości tłuszczów nasyconych

Słupki błędu oznaczają odchylenie standardowe obliczone na podstawie 15 pomiarów.

Na podstawie: E.T. Heinrichsen i inni, Metabolic and transcriptional response to a high-fat diet in Drosophila melanogaster, „Molecular Metabolism” 3, 2014, s. 42–54.

2.1. (0–1)

Oceń, czy poniższe interpretacje przedstawionych wyników badań są prawidłowe. Zaznacz T (tak), jeśli interpretacja wyników jest prawidłowa, albo N (nie) – jeśli jest nieprawidłowa.

1. W przypadku diety bogatej w tłuszcze nasycone pomiary zawartości kwasu mlekowego miały większą zmienność niż pomiary zawartości kwasu moczowego. T N
2. Wszystkie wyniki pomiarów względnej zawartości kwasu pirogronowego były mniejsze od czterech. T N
3. Najwyższy wynik pomiaru zawartości kwasu pirogronowego w próbie z pożywką standardową był mniejszy od najwyższego wyniku w próbie z pożywką o wysokiej zawartości tłuszczów nasyconych. T N

2.2 (0–1)

Wyjaśnij, dlaczego doświadczenie przeprowadzono na genetycznie identycznych osobnikach tej samej płci Drosophila melanogaster – należących do jednego szczepu w1118.

2.3. (0–1)

Określ, która grupa Drosophila melanogaster – I czy II – stanowiła w opisanym doświadczeniu próbę kontrolną. Odpowiedź uzasadnij, odwołując się do roli tej próby w interpretacji wyników doświadczenia.

2.4. (0–1)

Uzupełnij poniższe zdania tak, aby stanowiły poprawną interpretację uzyskanych wyników opisanego doświadczenia. W każdym nawiasie podkreśl właściwe określenie.

Zaobserwowany u osobników wywilżny karłowatej odżywiających się pokarmem bogatotłuszczowym (spadek / wzrost) poziomu kwasu mlekowego świadczy o (zmniejszeniu / zwiększeniu) intensywności przemian kwasu pirogronowego w cytozolu ich komórek. Zaobserwowane zaburzenia w metabolizmie kwasu pirogronowego mogą być efektem zwiększonej intensywności (redukcji / utleniania) kwasów tłuszczowych, jako że w wyniku tego procesu powstaje acetylokoenzym A, dostarczający grupy acetylowe do cyklu Krebsa.

Matura Maj 2021, Poziom rozszerzony (Formuła 2015)Zadanie 24. (2 pkt)

Wpływ człowieka na środowisko i jego ochrona Metody badawcze i doświadczenia Zamknięte (np. testowe, prawda/fałsz) Podaj i uzasadnij/wyjaśnij

Zbieranie plonów z upraw prowadzi do wyjaławiania gleb, dlatego tak istotne jest ich nawożenie. Zapotrzebowanie na składniki mineralne u roślin bada się, stosując w uprawie pożywki pełne (zawierające wszystkie niezbędne dla rozwoju rośliny mikro- i makroelementy) oraz pożywki lub roztwory, z których wyklucza się określone jony. Rośliny uprawia się w doniczkach wypełnionych żwirem uprzednio wypłukanym w wodzie destylowanej i wyprażonym. Połowa uprawianych roślin stanowi próbę kontrolną, a połowa – próbę badawczą.

Na podstawie: H. Wiśniewski, Biologia, Warszawa 1995.

24.1. (0–1)

Wybierz i zaznacz wariant doświadczenia (A–D) umożliwiający wykazanie roli magnezu we wzroście i rozwoju roślin.

Próba kontrolna Próba badawcza
A. woda destylowana pożywka pełna
B. pożywka pełna pożywka bez źródła magnezu
C. woda destylowana z dodatkiem źródła magnezu pożywka pełna
D. pożywka pełna woda destylowana

24.2. (0–1)

Wyjaśnij, dlaczego w zbiorowiskach naturalnych, w przeciwieństwie do nienawożonych pól uprawnych, zawartość fosforu w glebie utrzymuje się na względnie stałym poziomie. W odpowiedzi uwzględnij porównanie tych dwóch rodzajów ekosystemów.

Strony