Zadania maturalne z biologii

Znalezionych zadań - 1922

Strony

21

Matura Maj 2024, Poziom rozszerzony (Formuła 2015)Zadanie 15. (4 pkt)

Prokarionty Zamknięte (np. testowe, prawda/fałsz)

PET – poli(tereftalan etylenu) – to wielkocząsteczkowy polimer stosowany m.in. do produkcji włókien oraz butelek o wysokiej odporności na biodegradację.

Na składowisku ze sztucznymi tworzywami odkryto gatunek Gram-ujemnej bakterii Ideonella sakaiensis, który wykorzystuje produkty rozkładu PET jako źródło węgla i energii. Te bakterie wytwarzają enzym – PETazę, który rozkłada PET wydajniej niż inne enzymy – kutynazy, esterazy czy lipazy – występujące u innych saprobiontycznych bakterii oraz u grzybów. W środowisku naturalnym PET rozkłada się setki lat, ale PETaza może skrócić ten czas do zaledwie kilku tygodni.

Na podstawie: S. Yoshida i in., A bacterium that degrades and assimilates poly(ethylene terephthalate), „Science” 351, 2016.

15.1. (0–2)

Uzupełnij poniższe zdania tak, aby w poprawny sposób opisywały właściwości bakterii I. sakaiensis. W każdym nawiasie podkreśl właściwe określenie.

Ściana komórkowa u bakterii Gram-ujemnych jest (cieńsza / grubsza) niż u bakterii Gram-dodatnich. Ściana komórkowa I. sakaiensis (jest / nie jest) przeszkodą w pobieraniu PET do wnętrza komórki, a rozkład PET rozpoczyna się (w komórce / poza komórką).

15.2. (0–2)

Oceń, czy poniższe stwierdzenia związane z rozkładem PET przez mikroorganizmy są prawdziwe. Zaznacz P, jeśli stwierdzenie jest prawdziwe, albo F – jeśli jest fałszywe.

1. Biodegradacja PET przez bakterie I. sakaiensis przyczynia się do obiegu węgla w przyrodzie. P F
2. Bakterie I. sakaiensis są jedynymi znanymi organizmami zdolnymi do rozkładu PET. P F
3. Występowanie PET w środowisku jest przyczyną mutacji, dzięki którym u bakterii i u grzybów dochodzi do powstania genów kodujących PETazę. P F
22

Matura Maj 2024, Poziom rozszerzony (Formuła 2023)Zadanie 16. (4 pkt)

Dziedziczenie Uzupełnij/narysuj wykres, schemat lub tabelę Pozostałe

Tułów ryby – brzanki sumatrzańskiej (Puntigrus tetrazona) – przecinają trzy poprzeczne czarne paski, ciągnące się od grzbietu do brzucha. Na poniższym zdjęciu przedstawiono trzy możliwe wzory paskowania występujące u brzanki sumatrzańskiej (1.–3.), różniące się długością paska oznaczonego strzałką.

Wzór paskowania brzanki sumatrzańskiej zależy od dwóch niesprzężonych ze sobą loci – A i B z allelami dominującymi (A i B) i recesywnymi (a i b):

  • wzór 1. – obecność co najmniej jednego allelu dominującego w każdym z obu loci daje wzór pełnego paskowania
  • wzór 2. – homozygotyczność recesywna tylko w jednym z loci powoduje skrócenie paska środkowego, który jednak przecina linię naboczną
  • wzór 3. – podwójna homozygotyczność recesywna sprawia, że pasek środkowy jest skrócony o połowę i kończy się na linii nabocznej.
Na podstawie: Z. Nowak (red.), Genetyka zwierząt w teorii i praktyce, Warszawa 2015;
J.S. Frankel, Inheritance of Trunk Striping in the Sumatran Tiger Barb […], „Journal of Heredity” 76, 1985
Fotografia: J.S. Frankel, How a Banded Barb Gets its Stripes, „AMAZONAS” 3(6), 2014.

16.1. (0–2)

Uzupełnij tabelę – dla każdego z fenotypów brzanki sumatrzańskiej wymienionych w tabeli zapisz wszystkie możliwe genotypy warunkujące dany fenotyp. Zastosuj oznaczenia alleli podane w tekście.

Fenotyp Możliwe genotypy
pełne paskowanie – wzór 1.
skrócony pasek środkowy przecinający linię naboczną – wzór 2.

16.2. (0–2)

Zapisz krzyżówkę genetyczną i na jej podstawie podaj oczekiwany rozkład wzoru paskowania wśród potomstwa dwóch podwójnie heterozygotycznych osobników brzanki sumatrzańskiej.

Krzyżówka genetyczna:

Wzór paskowania wzór 1. wzór 2. wzór 3.
Oczekiwane proporcje : :
23

Matura Maj 2024, Poziom rozszerzony (Formuła 2023)Zadanie 17. (3 pkt)

Ekspresja informacji genetycznej Zamknięte (np. testowe, prawda/fałsz) Podaj/wymień

Na poniższym schemacie przedstawiono budowę przestrzenną cząsteczki tRNA.

Na podstawie: pdb101.rcsb.org

17.1. (0–1)

Dokończ zdanie. Zaznacz odpowiedź A albo B oraz odpowiedź 1. albo 2.

Cząsteczki tRNA są zbudowane

A. z jednej nici, a w budowie przestrzennej tRNA komplementarne odcinki nici są położone 1. w przeciwnej orientacji.
B. z dwóch nici, 2. w tej samej orientacji.

17.2. (0–2)

Określ funkcję pełnioną przez ramię akceptorowe oraz funkcję pełnioną przez antykodon cząsteczki tRNA.

Ramię akceptorowe:

Antykodon:

24

Matura Maj 2024, Poziom rozszerzony (Formuła 2015)Zadanie 17. (1 pkt)

Ewolucjonizm i historia życia na ziemi Podaj i uzasadnij/wyjaśnij

Zespół ciężkiego złożonego niedoboru odporności (SCID) u koni czystej krwi arabskiej jest jednogenową chorobą autosomalną, która dziedziczy się w sposób autosomalny recesywny. Chore źrebięta są podatne na zakażenia z powodu niesprawnego układu immunologicznego i zwykle nie dożywają 5. miesiąca życia.

Częstość występowania allelu powodującego zespół złożonego niedoboru odporności w pewnej hodowli koni arabskich liczącej 250 osobników wynosi 8,4%.

Na podstawie: M. Bugno-Poniewierska i in., Wykorzystanie testów molekularnych identyfikujących nosicieli mutacji SCID, CA i LFS w polskiej populacji koni czystej krwi arabskiej – wyniki wstępne, „Wiadomości Zootechniczne” LV(5), 2017.

Określ, czy locus genu warunkującego SCID w opisanej hodowli koni arabskich jest w równowadze Hardy’ego – Weinberga. Odpowiedź uzasadnij – podaj jeden argument.

25

Matura Maj 2024, Poziom rozszerzony (Formuła 2023)Zadanie 18. (2 pkt)

Ekspresja informacji genetycznej Zamknięte (np. testowe, prawda/fałsz) Podaj/wymień

Ekspresja informacji genetycznej u eukariontów składa się z trzech etapów: z transkrypcji, z obróbki potranskrypcyjnej i z translacji.

Na poniższym schemacie przedstawiono w uproszczony sposób fragment sekwencji nukleotydowej nici matrycowej DNA. Kolorem pomarańczowym zaznaczono sekwencję promotorową, a kolorem niebieskim – introny. Sekwencje nukleotydowe eksonów ujęto w ramki.

18.1. (0–1)

Jaką sekwencję nukleotydową będzie miał fragment dojrzałego mRNA transkrybowany na podstawie przedstawionej nici matrycowej? Zaznacz właściwą odpowiedź spośród podanych.

  1. 5′ UAUUAUACUGCUACGGGCGCACAACGUAUGCCAUGACAAUU 3′
  2. 5′ AUAAUAUGACGAUGCCCGCGUGUUGCAUACGGUACUGUUAA 3′
  3. 5′ AUGACGAUGCCCGCGUGUGUGUGAUGCAUACGGUAC 3′
  4. 5′ AUGACGAUGCCCGCGUGUUGCAUACGGUACUGUUAA 3′

18.2. (0–1)

Podaj sekwencję aminokwasową kodowaną przez pierwszy ekson przedstawionego genu. Odpowiedź zapisz od końca aminowego do końca karboksylowego, z wykorzystaniem pełnych nazw aminokwasów lub ich oznaczeń trójliterowych.

26

Matura Maj 2024, Poziom rozszerzony (Formuła 2023)Zadanie 19. (2 pkt)

Mutacje Zamknięte (np. testowe, prawda/fałsz)

Przewlekła białaczka szpikowa to choroba o podłożu genetycznym. W komórce macierzystej szpiku kostnego w wyniku mutacji powstaje fuzyjny gen składający się z fragmentów dwóch genów: BCR oraz ABL1. Funkcja genu BCR jest nieznana. Gen ABL1 koduje enzym – kinazę tyrozynową, która fosforyluje różne białka i wpływa w ten sposób na procesy komórkowe. Komórka szpiku kostnego z fuzją genów BCR i ABL1 nie podlega wewnątrzkomórkowym procesom regulującym podziały komórkowe i dzieli się w sposób niekontrolowany, co prowadzi do rozwoju nowotworu.

Na poniższym schemacie przedstawiono strukturę chromosomów przed mutacją i po mutacji.

Na podstawie: J. Żołnierowicz i in., Patogeneza przewlekłej białaczki szpikowej – od genu do terapii celowanej, „Hematologia” 1(3), 2010.

19.1. (0–1)

Dokończ zdanie. Zaznacz właściwą odpowiedź spośród podanych.

Przyczyną przewlekłej białaczki szpikowej jest

  1. duplikacja.
  2. inwersja.
  3. translokacja.
  4. transkrypcja.

19.2. (0–1)

Oceń, czy poniższe stwierdzenia dotyczące mutacji będącej przyczyną przewlekłej białaczki szpikowej są prawdziwe. Zaznacz P, jeśli stwierdzenie jest prawdziwe, albo F – jeśli jest fałszywe.

1. Opisana mutacja powoduje zmiany w strukturze chromosomów oraz w ich liczbie. P F
2. Zmiany w strukturze chromosomów 9 i 22 – charakterystyczne dla przewlekłej białaczki szpikowej – są widoczne w kariotypie. P F
27

Matura Maj 2024, Poziom rozszerzony (Formuła 2023)Zadanie 20. (2 pkt)

Wpływ człowieka na środowisko i jego ochrona Podaj i uzasadnij/wyjaśnij Zamknięte (np. testowe, prawda/fałsz)

W drugiej połowie XX wieku naukowcy zwrócili uwagę na globalne zmniejszanie się liczebności populacji płazów. Badacze zgodnie określają obecny trend jako szóste masowe wymieranie zwierząt o globalnym zasięgu.

Badania prowadzone w Polsce wskazują kilka czynników negatywnie wpływających na liczebność płazów. Jednym z nich jest osuszanie naturalnych siedlisk płazów.

Na podstawie: naukadlaprzyrody.pl

20.1. (0–1)

Wykaż, że osuszanie siedlisk ma negatywny wpływ na liczebność płazów w Polsce.

20.2. (0–1)

Który z dokumentów i form ochrony przyrody reguluje zasady handlu gatunkami zagrożonymi wyginięciem? Zaznacz właściwą odpowiedź spośród podanych.

  1. Agenda 21
  2. Konwencja o Różnorodności Biologicznej
  3. Konwencja Waszyngtońska – CITES
  4. Natura 2000
28

Matura Maj 2024, Poziom rozszerzony (Formuła 2023)Zadanie 21. (3 pkt)

Metody badawcze i doświadczenia Fizjologia roślin Uzupełnij/narysuj wykres, schemat lub tabelę Podaj i uzasadnij/wyjaśnij

Oddziaływania międzygatunkowe u roślin mogą mieć charakter antagonistyczny, np. gdy w suchym środowisku występuje konkurencja korzeni o wodę, lub nieantagonistyczny – polegający na wzajemnym wspomaganiu wzrostu.

Aby określić wpływ wzajemnego oddziaływania roślin jednorocznych i krzewów Ambrosia dumosa, przygotowano na pustyni następujące poletka doświadczalne:

  • próba A – usunięto rośliny jednoroczne, a pozostawiono krzewy A. dumosa
  • próba B – pozostawiono rośliny jednoroczne oraz krzewy A. dumosa
  • próba C – pozostawiono rośliny jednoroczne, a usunięto krzewy A. dumosa.

Na poniższych ilustracjach przedstawiono próby: A, B i C.

Rośliny jednoroczne w obecności krzewów charakteryzowały się większym przyrostem biomasy, natomiast przyrost biomasy krzewów w obecności roślin zielnych był ograniczony.

Na podstawie: C.J. Krebs, Ecology: The Experimental Analysis of Distribution and Abundance, Harlow 2014.

21.1. (0–2)

Uzupełnij tabelę – wpisz w puste komórki oznaczenia literowe tych prób, które należy porównać, aby zweryfikować poniższe hipotezy.

Weryfikowana hipoteza Oznaczenia literowe prób, które należy porównać
Obecność na tym samym obszarze krzewów A. dumosa skutkuje zwiększeniem przyrostu biomasy roślin jednorocznych.
Obecność na tym samym obszarze roślin jednorocznych skutkuje ograniczeniem przyrostu biomasy krzewów A. dumosa.

21.2. (0–1)

Wyjaśnij, w jaki sposób rzucanie cienia przez krzewy A. dumosa wpływa pozytywnie na przyrost biomasy roślin jednorocznych w warunkach suszy. W odpowiedzi uwzględnij bilans wodny roślin.

29

Matura Maj 2024, Poziom rozszerzony (Formuła 2015)Zadanie 22. (1 pkt)

Wpływ człowieka na środowisko i jego ochrona Podaj i uzasadnij/wyjaśnij

W Sudetach przeprowadzono restytucję jodły z wykorzystaniem wyłącznie lokalnych zasobów genetycznych jodły. Wymagało to wielu długotrwałych działań, często skomplikowanych (np. szczepienia drzew). Jodła sudecka różni się genetycznie od jodły karpackiej, licznie występującej w niektórych rejonach Karpat i wytwarzającej duże ilości nasion.

Na podstawie: W. Barzdajn, Restytucja jodły pospolitej w Sudetach. Dotychczasowe osiągnięcia, „Studia i Materiały Centrum Edukacji Przyrodniczo Leśnej” 1(11), 2006.

Uzasadnij, że do restytucji jodły w Sudetach należało użyć lokalnych zasobów genetycznych jodły, zamiast łatwo dostępnych nasion pochodzących z Karpat.

30

Zadania autorskie BiologHelp 2023, Poziom rozszerzony (Formuła 2023)Zadanie 1. (2 pkt)

Skład organizmów Zamknięte (np. testowe, prawda/fałsz) Podaj i uzasadnij/wyjaśnij

Albuminy są jedną z grup białek występującą m.in. w osoczu krwi lub mleku. Albuminy ludzkie występujące w osoczu są białkami prostymi, zbudowanymi z pojedynczego łańcucha polipeptydowego. Pełnią ważne funkcje dla organizmu, stąd w przypadku nagłej utraty tych białek może zaistnieć potrzeba ich dożylnego podania pacjentowi. Przyczyną utraty albumin może być np. choroba nerek wiążąca się z nasilonym białkomoczem. Albuminy przetaczane pacjentom pozyskiwane są z osocza zdrowych dawców. Izoluje się je metodą frakcjonowania etanolem, a następnie ogrzewa przez ok. 10 h w temperaturze do 60°C w celu inaktywacji ewentualnych wirusów. Wykazano, że przygotowanie preparatu zgodnie z powyższą procedurą nie wpływa istotnie na funkcję albumin.

1.1 (0-2)

Oceń, czy poniższe stwierdzenia dotyczące albumin są prawdziwe. Zaznacz P, jeśli stwierdzenie jest prawdziwe, albo F – jeśli jest fałszywe.

1. Albuminy obecne we krwi pełnią m.in. funkcję transportową dla niektórych substancji. P F
2. Albuminy są białkami trudno rozpuszczalnymi w wodzie, które odpowiadają za utrzymanie wody w naczyniach krwionośnych. P F
3. Do albumin należą m.in. przeciwciała odpornościowe. P F

1.2 (0-1)

Wyjaśnij, dlaczego stosowanie temperatur wyższych niż 60°C celem inaktywacji wirusów w preparacie albumin może negatywnie wpłynąć na jego właściwości. W odpowiedzi odnieś się do potencjalnego wpływu wyższej temperatury na strukturę przestrzenną albumin.

Strony