Ekspresja informacji genetycznej

Oto lista zadań maturalnych z danego działu biologii. Aby skorzystać z dodatkowych opcji lub wybrać zadania z pozostałych działów kliknij poniżej.

Przejdź do wyszukiwarki zadań

 

Matura Lipiec 2020, Poziom rozszerzony (Formuła 2015)Zadanie 18. (5 pkt)

Dziedziczenie Ekspresja informacji genetycznej Genetyka - pozostałe Ewolucjonizm i historia życia na ziemi Podaj i uzasadnij/wyjaśnij Podaj/wymień

Dystrofia mięśniowa Duchenne'a jest najczęstszą i najcięższą z postępujących dystrofii mięśniowych. Jest to choroba genetycznie uwarunkowana – dziedziczy się w sposób recesywny sprzężony z płcią. Wynikiem obecności nieprawidłowego allelu d genu DMD, jest synteza nieprawidłowej dystrofiny w komórce mięśniowej – białka tworzącego ,,szkielet" komórki mięśniowej. Chorzy umierają zwykle w wieku przedreprodukcyjnym.

Poniżej na schemacie przedstawiono fragment sekwencji nukleotydowej DNA (poszczególne kodony zostały oddzielone przerwami) prawidłowego (I) i zmutowanego genu DMD (II). Zamieszczone fragmenty nie zawierają intronów.

I. Fragment prawidłowej sekwencji nici kodującej:
5’ CAG CAG CAG CAG CAG 3’

II. Fragment sekwencji nici kodującej, w której występuje mutacja:
5’ CAG CAG TAG CAG CAG 3’

18.1. (0–1)

Wpisz, posługując się trójliterowymi skrótami nazw aminokwasów, w wykropkowane miejsca na schemacie sekwencję kodowanego fragmentu białka, zakodowanego w zapisanych fragmentach DNA I i II genu DMD.

18.2. (0–1)

Na podstawie sekwencji I i II genu DMD określ rodzaj mutacji genowej warunkującej rozwój dystrofii mięśniowej Duchenne’a.

18.3. (0–1)

Określ, jakie będą skutki przedstawionej mutacji dla pierwszorzędowej struktury białka, w porównaniu z jego prawidłową strukturą.

18.4. (0–1)

Wyjaśnij, dlaczego mimo działania doboru naturalnego w populacji ludzkiej utrzymuje się allel warunkujący zespół Duchenne’a.

18.5. (0–2)

Określ, jakie jest prawdopodobieństwo, że kolejne dziecko zdrowych rodziców, którzy mają już jednego syna chorego na dystrofię mięśniową typu Duchenne’a, będzie chore na tę chorobę. W odpowiedzi uwzględnij genotypy rodziców oraz zapisz krzyżówkę genetyczną lub obliczenia.

Prawdopodobieństwo, że kolejne dziecko tych rodziców będzie chore: %

Matura Czerwiec 2021, Poziom rozszerzony (Formuła 2015)Zadanie 18. (4 pkt)

Ekspresja informacji genetycznej Uzupełnij/narysuj wykres, schemat lub tabelę Podaj/wymień

Na schemacie przedstawiono, w uproszczony sposób, syntezę pewnego peptydu.

Na podstawie: https://en.wikipedia.org/wiki/Ribosomal_pause#/media/File:Peptide_syn.png

18.1. (0–1)

Uzupełnij powyższy schemat.

  1. Wpisz w puste prostokąty odpowiednie oznaczenia (3ʹ lub 5ʹ) obu końców nici cząsteczki mRNA.
  2. Dorysuj do linii grot strzałki wskazującej kierunek odczytu informacji genetycznej.

18.2. (0–1)

Zapisz kodon, oznaczony na schemacie literami XYZ, kodujący metioninę rozpoczynającą ten peptyd, oraz podaj nazwę aminokwasu oznaczonego na schemacie literą α, który jako kolejny zostanie dołączony do syntezowanego peptydu.

  1. Kodon XYZ:
  2. Aminokwas α:

18.3. (0–1)

Określ, z ilu aminokwasów będzie ostatecznie zbudowany ten peptyd, jeżeli po translacji metionina zostanie odcięta.

Liczba aminokwasów budujących peptyd:

18.4. (0–1)

We fragmencie DNA, w którym jest zapisana sekwencja aminokwasowa przedstawionego peptydu, doszło w nici kodującej do podstawienia adeniny na guaninę w trzeciej pozycji kodonu kodującego lizynę.

Określ skutek tej mutacji na poziomie sekwencji aminokwasowej peptydu.

Informator CKE, Poziom rozszerzony (Formuła 2023)Zadanie 14. (8 pkt)

Układ immunologiczny Choroby człowieka Ekspresja informacji genetycznej Metody badawcze i doświadczenia Uzupełnij/narysuj wykres, schemat lub tabelę Zamknięte (np. testowe, prawda/fałsz) Podaj i uzasadnij/wyjaśnij

Współcześnie stosuje się dwie podstawowe metody wykrywania zakażeń HIV. Rutynowe badanie polega na wykrywaniu przeciwciał anty-HIV w surowicy pacjenta. W przypadku tej metody czułość badania, czyli prawdopodobieństwo otrzymania wyniku dodatniego u osoby chorej, tzn. wykrycia zakażenia, wynosi 100%, ale wynik dodatni otrzymuje się także dla 0,5% zdrowych osób – specyficzność wynosi 99,5%. Dlatego postawienie diagnozy zakażenia HIV wymaga potwierdzenia dodatkowym badaniem za pomocą metody PCR, wykrywającym gen odwrotnej transkryptazy wbudowany w genom gospodarza. Ta metoda jest teoretycznie bezbłędna pod warunkiem utrzymywania wysokich standardów pracy laboratoryjnej. Odpowiednie próby kontrolne służą sprawdzeniu, czy:

  • polimeraza DNA nie utraciła aktywności podczas przechowywania (kontrola pozytywna),
  • wszystkie odczynniki są wolne od wirusowego materiału genetycznego (kontrola negatywna).

Dla trzech pacjentów uzyskano dodatni wynik testu na obecność przeciwciał anty-HIV. Z tego powodu lekarz zlecił dodatkowe badanie z wykorzystaniem metody PCR, którego wyniki podsumowano w poniższej tabeli.

Próba
badawcza kontrolna pozytywna kontrolna negatywna
Pacjent 1. +
Pacjent 2. + + +
Pacjent 3. + +

Na podstawie: GenBank sekwencja nr KR861191.1; M. Fearon, The Laboratory Diagnosis of HIV Infections, „Can J Dis Med Microbiol” 16, 2005, s. 26–30;
D.S Boyle i inni, Rapid Detection of HIV-1 Proviral DNA for Early Infant Diagnosis Using Recombinase Polymerase Amplification, „mBio” 4, 2013, e00135–13;
S. Koblavi-Dème i inni, Sensitivity and Specificity of Human Immunodeficiency Virus Rapid Serologic Assays and Testing Algorithms in an Antenatal Clinic in Abidjan, Ivory Coast, „J Clin Microbiol” 39, 2001, s. 1808–1812.

14.1. (0–2)

Zaprojektuj doświadczenie PCR wykrywające DNA HIV wbudowane w genom gospodarza. Dla każdej z prób – badawczej, kontrolnej pozytywnej i kontrolnej negatywnej – wybierz wszystkie właściwe składniki mieszaniny reakcyjnej. Wpisz w tabelę znak „+”, jeśli składnik należy dodać do próby, albo znak „–”, jeśli ten składnik należy pominąć.

Próba
badawcza kontrolna pozytywna kontrolna negatywna
DNA genomowy wyizolowany od pacjenta
DNA genomowy wyizolowany z linii komórkowej zakażonej HIV
para specyficznych starterów
bufor zapewniający optymalne pH i stężenie jonów Mg2+
termostabilna polimeraza DNA
mieszanina deoksyrybonukleotydów

14.2. (0–1)

Wybierz spośród A–D i zaznacz prawidłowe sekwencje starterów polF1 i polR1, wykorzystywanych w teście diagnostycznym HIV, przyłączających się do zaznaczonych fragmentów poniższej sekwencji genu odwrotnej transkryptazy wirusa HIV, wbudowanej w genom gospodarza.

  1. polF1 5′ CCCTACAATCCCCAAAGTCAAGGAGTAGTAGAA 3′
    polR1 5′ CTCTGGAAAGGTGAAGGGGCAGTAGTAATACA 3′
  2. polF1 5′ TTCTACTACTCCTTGACTTTGGGGATTGTAGGG 3′
    polR1 5′ TGTATTACTACTGCCCCTTCACCTTTCCAGAG 3′
  3. polF1 5′ CCCTACAATCCCCAAAGTCAAGGAGTAGTAGAA 3′
    polR1 5′ TGTATTACTACTGCCCCTTCACCTTTCCAGAG 3′
  4. polF1 5′ TTCTACTACTCCTTGACTTTGGGGATTGTAGGG 3′
    polR1 5′ CTCTGGAAAGGTGAAGGGGCAGTAGTAATACA 3′

14.3. (0–2)

Podpunkt anulowany przez CKE

Przed zabiegiem chirurgicznym pacjentowi wykonano testy na nosicielstwo wirusa HIV wykrywające przeciwciała anty-HIV. Wynik wyszedł dodatni. Pacjent nie znajduje się w żadnej z grup ryzyka zakażenia HIV. Według oficjalnych danych częstość występowania zakażenia HIV w Polsce wynosi ok. 40 osób na 100 tys.

Oblicz prawdopodobieństwo, że pacjent jest zakażony HIV, z uwzględnieniem czułości i specyficzności testu na przeciwciała anty-HIV. Zapisz obliczenia w wyznaczonych miejscach 1.–3.

  1. Oczekiwana liczba osób zakażonych HIV, u których wynik testu na przeciwciała anty-HIV będzie dodatni, wśród 100 tys. losowo przebadanych osób:
  2. Oczekiwana liczba osób zdrowych (niezakażonych), u których wynik testu na przeciwciała anty-HIV będzie dodatni, wśród 100 tys. losowo przebadanych osób:
  3. Prawdopodobieństwo, że pacjent z dodatnim wynikiem testu na przeciwciała anty-HIV jest zakażony HIV:

14.4. (0–1)

Oceń, czy poniższe interpretacje przedstawionych wyników badań trojga pacjentów są prawidłowe. Zaznacz T (tak), jeśli interpretacja jest prawidłowa, albo N (nie) – jeśli jest nieprawidłowa.

1. U pacjenta 1. wynik testu na przeciwciała anty-HIV był fałszywie dodatni, o czym świadczy wykluczenie zakażenia na podstawie wyników PCR. T N
2. Wyniki testu PCR dla pacjenta 2. są niewiarygodne ze względu na dodatni wynik w próbie kontrolnej negatywnej – należy powtórzyć badanie. T N
3. Dodatkowe badanie techniką PCR potwierdziło podejrzenie, że pacjent 3. jest zakażony HIV. T N

14.5. (0–1)

Wyjaśnij, dlaczego testy wykrywające przeciwciała anty-HIV nie nadają się do diagnostyki zakażeń HIV u noworodków i niemowląt urodzonych przez matki zakażone HIV. W odpowiedzi uwzględnij spodziewany wynik testu oraz funkcjonowanie układu odpornościowego matki.

14.6. (0–1)

Oceń, czy poniższe osoby znajdują się w grupie zwiększonego ryzyka zakażenia HIV. Zaznacz T (tak), jeśli się w niej znajdują, albo N (nie) – jeśli w niej się nie znajdują.

1. Osoby przebywające w jednym pomieszczeniu z osobami zakażonymi HIV, np. w pracy lub szkole. T N
2. Osoby narażone na częste ukąszenia komarów i innych owadów odżywiających się krwią. T N
3. Sąsiedzi osób zakażonych HIV, mieszkający w tym samym domu wielorodzinnym. T N

Informator CKE, Poziom rozszerzony (Formuła 2023)Zadanie 12. (2 pkt)

Ekspresja informacji genetycznej Zamknięte (np. testowe, prawda/fałsz)

Uzupełnij poniższe zdania tak, aby powstał poprawny opis zjawiska alternatywnego składania eksonów. W każdym nawiasie podkreśl właściwe określenie.

W wyniku alternatywnego składania eksonów może powstać (tylko jeden rodzaj / wiele rodzajów) mRNA. Dzięki temu w organizmach eukariotycznych obserwuje się znacznie (mniej / więcej) różnych białek w porównaniu z liczbą genów w genomie. Ze względu na to, że ten proces nie zachodzi w organizmach prokariotycznych, gdy planuje się otrzymanie eukariotycznego białka w komórkach bakterii, należy przeprowadzić odwrotną (transkrypcję / translację) mRNA, która pozwala uzyskać gen pozbawiony (eksonów / intronów).

Biomedica 2022, Poziom rozszerzony (Formuła 2015)Zadanie 26. (3 pkt)

Skład organizmów Ekspresja informacji genetycznej Podaj i uzasadnij/wyjaśnij Podaj/wymień

Poniżej przedstawiono schemat budowy polirybosomu.

26.1. (0–1)

Podaj, z jakiego rodzaju RNA zbudowane są rybosomy.

26.2. (0–1)

Wyjaśnij, jakie znaczenie dla efektywności pracy komórki ma występowanie polirybosomów.

26.3. (0–1)

Podaj, jak nazywa się proces zachodzący na polirybosomie.

To zadanie pochodzi ze zbioru matura 2022 wydawnictwa Biomedica
Kup pełny zbiór zadań

Matura Maj 2021, Poziom rozszerzony (Formuła 2015)Zadanie 19. (5 pkt)

Układ krążenia Choroby człowieka Dziedziczenie Ekspresja informacji genetycznej Zamknięte (np. testowe, prawda/fałsz) Podaj i uzasadnij/wyjaśnij Podaj/wymień

W strukturze genu obok fragmentów kodujących (eksonów) mogą występować elementy niekodujące, takie jak promotor lub introny.

W poniższej tabeli przedstawiono informacje na temat sześciu wybranych genów człowieka, oznaczonych numerami 1.–6., kodujących określone białka.

Oznaczenie genu Kodowane białko Oznaczenie chromosomu Wielkość genu (kpz DNA) Wielkość mRNA (kz)
1. α-globina 16 0,8 0,5
2. albumina 4 25,0 2,1
3. receptor LDL 19 45,0 5,5
4. kinaza zależna od cyklin 4 54,0 1,7
5. hydroksylaza fenyloalaninowa 12 90,0 2,4
6. dystrofina X 2000,0 16,0

kpz – tysiąc par zasad
kz – tysiąc zasad

Na podstawie: red. J. Bal, Biologia molekularna w medycynie, Warszawa 2013;
https://ghr.nlm.nih.gov/gene;
https://www.ncbi.nlm.nih.gov.

19.1. (0–1)

Podaj nazwę procesu, którego produktem jest pre-mRNA, oraz określ lokalizację tego procesu w komórce człowieka.

Nazwa procesu:
Lokalizacja procesu:

19.2. (0–1)

Wyjaśnij, z czego wynikają różnice między wielkościami genów a wielkościami cząsteczek mRNA, które im odpowiadają.

19.3. (0–1)

Podaj nazwę choroby, u podłoża której leży mutacja genu kodującego hydroksylazę fenyloalaninową, prowadząca do utraty funkcji tego enzymu niezbędnego w metabolizmie fenyloalaniny.

19.4. (0–1)

Spośród wymienionych w tabeli wybierz i zapisz oznaczenia pary genów, które mogą dziedziczyć się niezgodnie z II prawem Mendla. Odpowiedź uzasadnij, odwołując się do treści tego prawa oraz do lokalizacji wybranych genów w genomie.

19.5. (0–1)

Uzupełnij poniższe zdania tak, aby powstał poprawny opis dotyczący albumin. Podkreśl w każdym nawiasie właściwe określenie.

Albuminy to białka (rozpuszczalne / nierozpuszczalne) w wodzie, występujące głównie (w cytoplazmie erytrocytów / w osoczu krwi). Główną funkcją tych białek jest (transport tlenu / regulacja ciśnienia osmotycznego krwi).

Matura Maj 2021, Poziom rozszerzony (Formuła 2015)Zadanie 1. (3 pkt)

Skład organizmów Ekspresja informacji genetycznej Podaj i uzasadnij/wyjaśnij Podaj/wymień

Prolaktyna, wydzielana przez gruczołową część przysadki mózgowej, jest jednołańcuchowym polipeptydem złożonym ze 199 aminokwasów, powstającym w wyniku odcięcia peptydu sygnałowego liczącego 28 aminokwasów. Na poniższym schemacie przedstawiono strukturę przestrzenną cząsteczki dojrzałej ludzkiej prolaktyny.

Na podstawie: S.J. Konturek, Fizjologia człowieka, Wrocław 2013; Protein Data Bank, https://www.rcsb.org/structure/1RW5.

1.1. (0–1)

Określ dominującą strukturę II-rzędową w cząsteczce dojrzałej ludzkiej prolaktyny.

1.2. (0–1)

Na podstawie przedstawionych informacji określ najwyższą rzędowość struktury białka – prolaktyny. Odpowiedź uzasadnij, odwołując się do cech budowy tego białka.

1.3. (0–1)

Podaj całkowitą liczbę kodonów w mRNA stanowiącym matrycę podczas syntezy prolaktyny.

Matura Marzec 2021, Poziom rozszerzony (Formuła 2015)Zadanie 2. (5 pkt)

Budowa i funkcje komórki Ekspresja informacji genetycznej Podaj/wymień Zamknięte (np. testowe, prawda/fałsz)

Na poniższym rysunku przedstawiono jeden z etapów translacji. Literami: E, P i A zaznaczono trzy miejsca funkcyjne rybosomu.

https://pl.khanacademy.org

2.1. (0–1)

Podaj nazwę aminokwasu oznaczonego na rysunku literą X.

Nazwa aminokwasu:

2.2. (0–1)

Oceń czy poniższe stwierdzenia dotyczące rybosomów w komórkach eukariotycznych są prawdziwe. Zaznacz P, jeśli stwierdzenie jest prawdziwe, albo F – jeśli jest fałszywe.

1. Funkcjonalny rybosom w komórce eukariotycznej składa się z dwóch podjednostek: małej i dużej, które są zbudowane z białek i rRNA. P F
2. Wszystkie rybosomy w komórce eukariotycznej są jednakowej wielkości i pełnią te same funkcje. P F
3. W komórkach eukariotycznych białka produkowane na eksport powstają na rybosomach związanych z siateczką śródplazmatyczną. P F

2.3. (0–2)

Do funkcji rybosomu 1.–4., pełnionych podczas translacji przez poszczególne miejsca funkcyjne rybosomu, przyporządkuj ze schematu ich odpowiednie oznaczenia wybrane spośród: E, P lub A.

  1. Przyłączanie inicjatorowego tRNA rozpoczynającego translację:
  2. Wiązanie aminoacylo-tRNA:
  3. Wiązanie peptydylo-tRNA:
  4. Uwalnianie z rybosomu wolnego tRNA:

2.4. (0–1)

Uzupełnij poniższe zdania tak, aby zawierały one prawdziwe informacje dotyczące translacji. Podkreśl w każdym nawiasie właściwe określenie.

Do połączenia podjednostek rybosomu dochodzi tylko w przypadku przyłączenia do (małej / dużej) podjednostki odpowiedniego rodzaju kwasu nukleinowego – (tRNA / końca 3ʹ mRNA / końca 5ʹ mRNA). Zachodzi wtedy proces (inicjacji / elongacji / terminacji) translacji.

Matura Maj 2020, Poziom podstawowy (Formuła 2007)Zadanie 19. (2 pkt)

Ekspresja informacji genetycznej Podaj i uzasadnij/wyjaśnij

Kod genetyczny to reguła, według której informacja genetyczna zapisana w sekwencji nukleotydów jest tłumaczona na sekwencję aminokwasów w białku. Jedną z cech kodu genetycznego jest możliwość zapisania jednego aminokwasu za pomocą różnych kodonów.

a)Określ, na którym etapie ekspresji informacji genetycznej – transkrypcji czy translacji – komórka bezpośrednio wykorzystuje kod genetyczny. Odpowiedź uzasadnij.
b)Podaj nazwę cechy kodu genetycznego opisanej w tekście i wykaż jej znaczenie dla zmniejszenia szkodliwych skutków mutacji zachodzących w materiale genetycznym.

Matura Maj 2020, Poziom rozszerzony (Formuła 2007)Zadanie 22. (2 pkt)

Budowa i funkcje komórki Ekspresja informacji genetycznej Podaj/wymień Podaj i uzasadnij/wyjaśnij

Na rysunku przedstawiono etapy pewnego procesu zachodzącego z udziałem siateczki śródplazmatycznej. Ten proces wymaga rozpoznawania sekwencji sygnałowej przez cząstki rozpoznające sygnał (SRP).

Na podstawie: P.C. Turner, A.G. McLennan, Krótkie wykłady. Biologia molekularna, Warszawa 2002.

a)Podaj nazwę i określ funkcję związku chemicznego oznaczonego na rysunku literą X.

Nazwa związku X:
Funkcja:

b)Określ, czy proces zilustrowany na rysunku zachodzi w organizmach prokariotycznych, czy – w eukariotycznych. Odpowiedź uzasadnij.

Matura Maj 2020, Poziom rozszerzony (Formuła 2007)Zadanie 21. (2 pkt)

Prokarionty Ekspresja informacji genetycznej Podaj i uzasadnij/wyjaśnij Zamknięte (np. testowe, prawda/fałsz)

Na schematach A i B przedstawiono jeden z mechanizmów regulacji ekspresji genów u bakterii. Przedstawiają one różny sposób działania represora, zależnie od obecności związku X.

Na podstawie: J. Kączkowski, Biochemia roślin, Warszawa 1992.

a)Na podstawie schematu B opisz, w jaki sposób związek chemiczny X wpływa na ekspresję genów struktury u bakterii.
b)Wybierz spośród A–D i zaznacz właściwe dokończenie zdania.

Regulacja ekspresji genów u eukariontów

  1. ma taki sam przebieg jak u bakterii.
  2. odbywa się tylko na poziomie replikacji i transkrypcji.
  3. odbywa się na wielu różnych poziomach.
  4. jest możliwa dzięki wytworzeniu chromosomów.

Zbiór zadań CKE, Poziom rozszerzony (Formuła 2015)Zadanie 100. (4 pkt)

Choroby człowieka Ekspresja informacji genetycznej Genetyka - pozostałe Podaj i uzasadnij/wyjaśnij Podaj/wymień

Na rysunku przedstawiono fragment genu oraz fragment powstałego na jego podstawie mRNA, a następnie fragment zsyntetyzowanego polipeptydu przed mutacją oraz po mutacji.

Na podstawie: L.B. Jorde, J.C. Carey, M.J. Bamshad, Genetyka medyczna, Wrocław 2014, s. 27.

a)Wyjaśnij, na czym polega przedstawiony rodzaj mutacji, uwzględniając najpierw sekwencję nukleotydów w genie, a następnie przebieg i wynik procesu ekspresji informacji genetycznej zawartej w tym genie.
b)Przyjmując, że na DNA nie działały czynniki mutagenne, podaj typową przyczynę powstawania takich mutacji, jak zilustrowana na schemacie.
c)Korzystając z tabeli kodu genetycznego (zamieszczonego w zestawie Wybranych wzorów i stałych fizykochemicznych na egzamin maturalny z biologii, chemii i fizyki), odczytaj, które trzy aminokwasy zostaną wbudowane do polipeptydu po zajściu tej mutacji i wpisz w wykropkowane miejsca skróty ich nazw.
d)Spośród wymienionych niżej chorób człowieka wybierz i podkreśl tę, której przyczyną może być przedstawiony typ mutacji.

Nazwy chorób: miażdżyca, mukowiscydoza, anemia złośliwa, zespół Klinefeltera, cukrzyca, zespół Turnera.

Zbiór zadań CKE, Poziom rozszerzony (Formuła 2015)Zadanie 99. (3 pkt)

Skład organizmów Ekspresja informacji genetycznej Zamknięte (np. testowe, prawda/fałsz) Podaj/wymień

Na rysunku przedstawiono główne etapy ekspresji informacji genetycznej.

Na podstawie: E.P. Solomon, L.R. Berg, D.W. Martin, C.A. Ville, Biologia. Warszawa 1996, s. 279.

a)Korzystając z informacji podanych na rysunku i własnej wiedzy, oceń prawdziwość poniższych stwierdzeń. Wpisz znak X w odpowiednie komórki tabeli.
Lp. Informacja Prawda Fałsz
1. Każda z nici DNA oraz nić mRNA zbudowane są z podobnych podjednostek chemicznych połączonych ze sobą za pomocą takich samych wiązań kowalencyjnych.
2. Dwuniciowy DNA oraz mRNA zbudowane są z nukleotydów purynowych i pirymidynowych, a stosunek ilościowy tych nukleotydów w obu kwasach wynosi 1 : 1.
3. Strukturę przestrzenną DNA i mRNA stabilizują wiązania wodorowe pomiędzy komplementarnymi zasadami azotowymi nukleotydów.
b)Stosując oznaczenia literowe zasad azotowych, podaj kodon 2 i kodon 3 w mRNA oraz w nici matrycowej DNA.
c)Zaznacz prawidłowe dokończenie zdania.

Na podstawie przedstawionego schematu ekspresji informacji genetycznej można stwierdzić, że

  1. podczas transkrypcji trójkowy kod genetyczny ulega rozszyfrowaniu.
  2. podczas translacji dany kodon znajdujący się w DNA zostaje odczytany dwa razy.
  3. podczas transkrypcji – mimo zmiany zapisu informacji genetycznej – nie zmienia się jej sens.
  4. zmiana nukleotydu w danym kodonie powoduje zmianę jednego aminokwasu w białku.

Zbiór zadań CKE, Poziom rozszerzony (Formuła 2015)Zadanie 95. (1 pkt)

Ekspresja informacji genetycznej Podaj i uzasadnij/wyjaśnij

W komórkach E. coli operon laktozowy (lac) zawiera geny struktury kodujące enzymy niezbędne do rozkładu laktozy i jej pobierania ze środowiska zewnętrznego. Transkrypcja tych genów zależy od warunków środowiska. Jeżeli w środowisku bakterii nie ma laktozy, to represor lac – specjalne (allosteryczne) białko – wiąże się z operatorem, uniemożliwiając przyłączenie do promotora polimerazy RNA i rozpoczęcie transkrypcji genów struktury.
Na rysunku przedstawiono operon laktozowy (I) oraz wpływ laktozy (induktora) na aktywność represora (II).

Na podstawie: Podstawy genetyki dla studentów i lekarzy, red. G. Drewa,T. Ferenc, Wrocław 2005, s. 94.

Korzystając z rysunku, opisz sposób, w jaki laktoza pobrana przez komórkę z podłoża wpływa na represor lac. Określ konsekwencje tego wpływu dla komórki i jej procesu oddychania.

Zbiór zadań CKE, Poziom rozszerzony (Formuła 2015)Zadanie 84. (4 pkt)

Ekspresja informacji genetycznej Genetyka - pozostałe Podaj i uzasadnij/wyjaśnij

Poniżej zilustrowano mutację, która jest przyczyną mukowiscydozy – choroby genetycznej autosomalnej recesywnej, upośledzającej funkcjonowanie płuc, trzustki i innych narządów. Ocenia się, że w populacji europejskiej choruje 1 na 2500 osób.

ALLEL PRAWIDŁOWY
Numer kodonu
Łańcuch DNA
Aminokwasy
 
503
ATC
Ile
 
507
ATC
Ile
 
508
TTT
Phe
 
509
GGT
Gly
 
510
GGT
Val
ALLEL ZMUTOWANY
Numer kodonu
Łańcuch DNA
Aminokwasy
 
506
ATC
Ile
 
507
AT-
Ile
 
508
--T
 
 
509
GGT
Gly
 
510
GGT
Val

Na podstawie: K.M. Charon, M. Świtoński, Genetyka zwierząt, Warszawa 2000, s. 121.

a)Korzystając z tabeli kodu genetycznego określ, czy przedstawiony fragment łańcucha DNA jest nicią kodującą, czy matrycową. Uzasadnij odpowiedź.
b)Uzasadnij na podstawie podanej informacji, że kod genetyczny jest zdegenerowany.
c)Podaj nazwę przedstawionego rodzaju mutacji genowej i określ skutek tej mutacji dla struktury I-rzędowej powstającego białka.
d)Oblicz, korzystając z równań Hardy’ego-Weinberga, częstość występowania nosicieli allelu mukowiscydozy w populacji europejskiej.

Zbiór zadań CKE, Poziom rozszerzony (Formuła 2015)Zadanie 2. (4 pkt)

Skład organizmów Ekspresja informacji genetycznej Zamknięte (np. testowe, prawda/fałsz) Podaj i uzasadnij/wyjaśnij Podaj/wymień

Węglowodany, białka, lipidy i kwasy nukleinowe to grupy związków organicznych występujących w organizmach. Poniżej przedstawiono wzór strukturalny pewnego związku organicznego.

a)Zaznacz poprawne dokończenie zdania.

Przedstawiony związek jest dipeptydem, ponieważ

  1. występują w nim grupy: hydroksylowa – OH i karboksylowa – COOH.
  2. występują w nim grupy: aminowa – NH2 i karboksylowa – COOH.
  3. występują w nim grupy: metylowa – CH3 i karboksylowa – COOH.
  4. występuje w nim jedno wiązanie peptydowe między monomerami.
b)Podaj nazwę pierwszego aminokwasu (od końca aminowego NH2) przedstawionego dipeptydu i wyjaśnij, czy może to być pierwszy aminokwas w syntetyzowanym łańcuchu polipetydowym. Skorzystaj z Wybranych wzorów i stałych fizykochemicznych na egzamin z biologii, chemii i fizyki.
c)Zakładając, że przedstawiony dipeptyd jest końcowym fragmentem powstającego podczas translacji łańcucha polipeptydowego, podaj do którego końca przedstawionego dipeptydu zostanie przyłączony kolejny aminokwas, np. lizyna. Odpowiedź uzasadnij.
d)Korzystając z Wybranych wzorów i stałych fizykochemicznych na egzamin z biologii, chemii i fizyki, podaj, jaki antykodon może mieć tRNA transportujący do rybosomu lizynę.

Matura Czerwiec 2019, Poziom rozszerzony (Formuła 2007)Zadanie 27. (2 pkt)

Ekspresja informacji genetycznej Zamknięte (np. testowe, prawda/fałsz) Podaj i uzasadnij/wyjaśnij

Na schemacie przedstawiono proces replikacji DNA w obrębie pojedynczych widełek replikacyjnych.

a)Wyjaśnij, dlaczego synteza komplementarnych nici polinukleotydowych przebiega w inny sposób wzdłuż nici A niż wzdłuż nici B.
b)Wymienionym poniżej nazwom enzymów (1.–3.) przyporządkuj spośród A–D funkcję, jaką pełni każdy z nich podczas replikacji.
  1. Łączenie kolejnych nukleotydów w łańcuch polinukleotydowy komplementarny do matrycy pojedynczej nici DNA.
  2. Katalizowanie powstawania wiązań fosfodiestrowych łączących fragmenty Okazaki.
  3. Rozplatanie helisy i rozrywanie wiązań wodorowych między nićmi w cząsteczce DNA, co umożliwia rozpoczęcie procesu replikacji.
  4. Usuwanie starterów RNA z nici.
  1. ligaza DNA
  2. polimeraza DNA
  3. helikaza DNA

Matura Czerwiec 2019, Poziom rozszerzony (Formuła 2015)Zadanie 18. (4 pkt)

Ekspresja informacji genetycznej Inżynieria i badania genetyczne Zamknięte (np. testowe, prawda/fałsz) Podaj/wymień

W procesie replikacji DNA bierze udział m.in. prymaza – enzym, który katalizuje syntezę starterów będących krótkimi odcinkami RNA, komplementarnymi do matrycowego DNA. Łańcuchowa reakcja polimerazy (PCR) naśladuje replikację DNA i służy do powielania fragmentu DNA bez udziału komórek – w probówce.

Na poniższym schemacie przedstawiono proces dobudowywania komplementarnej nici w czasie replikacji DNA w komórce.

Na podstawie: http://faculty.samford.edu/~djohnso2/44962w/405/06/CELL4e-Fig-06-04-0.jpg

18.1. (0–1)

Podaj, używając symboli: A, T, C, G, U, sekwencje nukleotydowe fragmentu nici RNA i fragmentu nici DNA, które zaznaczono klamrami na rysunku C.

RNA: 5’ 3’
DNA: 5’ 3’

18.2. (0–1)

Wybierz spośród A–D i zaznacz prawidłowe dokończenie poniższego zdania.

Replikacja DNA jądrowego zachodzi w czasie cyklu komórkowego podczas

  1. fazy G1.
  2. fazy S.
  3. fazy G2.
  4. fazy M.

18.3. (0–1)

Podaj nazwę wiązań występujących w cząsteczce DNA, które są rozrywane podczas replikacji przy udziale helikazy, oraz nazwę czynnika, który powoduje ich rozerwanie podczas przebiegu PCR.

Nazwa wiązań:
Nazwa czynnika:

18.4. (0–1)

Spośród wymienionych poniżej przykładów A–D wybierz i zaznacz ten, do którego niezbędne jest zastosowanie techniki PCR.

  1. Diagnostyka zespołu Turnera u noworodków.
  2. Określanie oporności szczepów bakterii na dany antybiotyk.
  3. Oznaczanie poziomu TSH (hormonu tyreotropowego) we krwi pacjenta.
  4. Ustalanie tożsamości przestępcy na podstawie śladowej ilości materiału genetycznego.

Matura Maj 2019, Poziom podstawowy (Formuła 2007)Zadanie 23. (2 pkt)

Ekspresja informacji genetycznej Uzupełnij/narysuj wykres, schemat lub tabelę Podaj i uzasadnij/wyjaśnij

W cząsteczce DNA jedna nić jest nicią kodującą, a druga – matrycową.

a)Uzupełnij tabelę – zapisz kolejność nukleotydów w cząsteczce mRNA powstałej na drodze transkrypcji nici matrycowej tego fragmentu DNA.
Fragment nici kodującej DNA ATG TTA CTA GAC
Fragment nici mRNA
b)Określ rolę mRNA w procesie biosyntezy białka.

Strony