Ekspresja informacji genetycznej

Oto lista zadań maturalnych z danego działu biologii. Aby skorzystać z dodatkowych opcji lub wybrać zadania z pozostałych działów kliknij poniżej.

Przejdź do wyszukiwarki zadań

 

Arkusz pokazowy CKE Marzec 2022, Poziom rozszerzony (Formuła 2023)Zadanie 18. (1 pkt)

Ekspresja informacji genetycznej Podaj i uzasadnij/wyjaśnij

Białko TBP jest czynnikiem transkrypcyjnym niezbędnym w procesie inicjowania transkrypcji genów eukariotycznych. Białko to wiąże się z promotorem genu, w którym zwykle występuje więcej par AT niż par GC. Białko TBP wygina dwuniciową cząsteczkę DNA o ok. 80 stopni, doprowadzając do rozdzielenia nici DNA. Umożliwia to przyłączenie do DNA polimerazy RNA i rozpoczęcie transkrypcji.

Wykaż, że większy udział par AT niż par GC w promotorze genu ułatwia rozdzielenie dwuniciowego DNA na pojedyncze nici.

Arkusz pokazowy CKE Marzec 2022, Poziom rozszerzony (Formuła 2023)Zadanie 14. (5 pkt)

Prokarionty Ekspresja informacji genetycznej Inżynieria i badania genetyczne Podaj/wymień Podaj i uzasadnij/wyjaśnij Zamknięte (np. testowe, prawda/fałsz)

Plazmidy bakteryjne zazwyczaj nie zawierają genów metabolizmu podstawowego, ale mogą np. zapewniać oporność na antybiotyki. Plazmidy lub ich fragmenty mogą być przekazywane między komórkami bakteryjnymi w czasie podziału komórki lub w procesach horyzontalnego transferu genów: koniugacji, transdukcji i transformacji. Plazmidy mogą dawać bakteriom przewagę selekcyjną. Znalazły one także zastosowanie w biotechnologii.

Bakterie mają wiele mechanizmów zapobiegających utracie plazmidów przez dzielące się komórki, np. system ccd plazmidu F bakterii Escherichia coli. Ten system tworzą dwa geny: gen ccdA kodujący antidotum oraz gen ccdB kodujący truciznę. Obydwa geny podlegają transkrypcji ze wspólnego promotora. Podczas normalnego funkcjonowania komórki bakteryjnej trucizna pozostaje związana przez antidotum i nie wywiera toksycznego wpływu na gyrazę – enzym usuwający napięcia w nici DNA powstające podczas replikacji materiału genetycznego. Jeśli komórka utraci po podziale plazmid z genami systemu ccd, obecne w jej cytoplazmie nietrwałe antidotum zostaje zdegradowane, a stosunkowo trwała toksyna wiąże się z gyrazą, co prowadzi do śmierci komórki w wyniku uszkodzenia DNA.

Aktywność promotora genów ccdA i ccdB jest hamowana przez produkty tych genów.

Na poniższych schematach przedstawiono funkcjonowanie systemu ccd:

  • schemat A – ekspresja genów ccdA oraz ccdB
  • schemat B – trucizna unieszkodliwiana przez antidotum
  • schemat C – degradacja antidotum i wiązanie trucizny z gyrazą.
Na podstawie: U. Zieleniewicz, P. Cegłowski, Mechanizmy stabilnego dziedziczenia plazmidów, „Kosmos” 51(3), 2002.

14.1. (0–1)

Podaj nazwę sposobu horyzontalnego transferu genów zachodzącego z udziałem wirusów.

14.2. (0–1)

Wykaż, że horyzontalny transfer genów zwiększa tempo ewolucji adaptacyjnej bakterii.

14.3. (0–1)

Uzupełnij poniższe zdania tak, aby opis dotyczący funkcjonowania genów systemu ccd był prawdziwy. W każdym nawiasie podkreśl właściwe określenie.

Ekspresja genów systemu ccd regulowana jest na zasadzie (negatywnego / pozytywnego) sprzężenia zwrotnego. Obecność w komórce produktów genów systemu ccd sprawia, że (zachodzi / nie zachodzi) transkrypcja tych genów.

14.4. (0–1)

Uzasadnij, że zahamowanie ekspresji genów systemu ccd doprowadzi do śmierci komórki zawierającej plazmid z tym systemem. W odpowiedzi uwzględnij produkty genów systemu ccd i ich trwałość w komórce.

14.5. (0–1)

Określ, w jakim celu do wektorów plazmidowych wykorzystywanych w inżynierii genetycznej wprowadza się gen oporności na antybiotyk.

Matura Czerwiec 2022, Poziom rozszerzony (Formuła 2015)Zadanie 15. (4 pkt)

Ekspresja informacji genetycznej Mutacje Zamknięte (np. testowe, prawda/fałsz) Podaj i uzasadnij/wyjaśnij Podaj/wymień

U owiec gen BMP15 zlokalizowany jest na chromosomie X i zawiera dwa eksony oddzielone od siebie intronem o długości ok. 5400 pz (par zasad), a pełna długość sekwencji kodującej (z uwzględnieniem kodonu stop) to 1182 pz. Propeptyd białka BMP15 (niedojrzałe białko) zawiera peptyd sygnałowy, który następnie ulega usunięciu. Dojrzała forma białka BMP15 składa się ze 125 aminokwasów.

W poniższej tabeli opisano dwa zmutowane allele genu BMP15. Allele Fec XB oraz Fec XL są odpowiedzialne za zwiększenie częstości owulacji u owiec.

Allel genu BMP15 Podstawienie nukleotydu w kodonie Pozycja podstawionego aminokwasu
w propeptydzie w dojrzałym białku
Fec XB AGC → AUC 367 99
Fec XL UGU → UAU 321 53
Na podstawie: G. Smołucha, A. Piestrzyńska-Kajtoch, B. Rejduch, Genetyczny aspekt wysokiej plenności u owiec. Cz. I, „Wiadomości Zootechniczne” 1, 2012.

15.1. (0–1)

Na podstawie przedstawionych informacji wykaż, że w procesie ekspresji genu BMP15 dochodzi do potranskrypcyjnej obróbki RNA.

15.2. (0–1)

Dokończ zdanie. Zaznacz właściwą odpowiedź spośród podanych.

Propeptyd białka BMP15 (niedojrzałe białko) zawiera

  1. 125 aminokwasów.
  2. 268 aminokwasów.
  3. 393 aminokwasy.
  4. 1179 aminokwasów.

15.3. (0–1)

Uzupełnij poniższe zdania tak, aby zawierały informacje prawdziwe. W każdym nawiasie podkreśl właściwe określenie.

Mutacje Fec XB i Fec XL są mutacjami (genowymi / chromosomowymi). Są to (mutacje punktowe / delecje), które (skutkują / nie skutkują) przesunięciem ramki odczytu.

15.4. (0–1)

Zapisz nazwy aminokwasów, którymi różnią się białko kodowane przez prawidłowy allel genu BMP15 i białko kodowane przez zmutowany allel Fec XL.

Nazwa aminokwasu w białku kodowanym przez

  1. prawidłowy allel:
  2. zmutowany allel Fec XL:

Matura Maj 2022, Poziom rozszerzony (Formuła 2015)Zadanie 18. (5 pkt)

Choroby człowieka Dziedziczenie Ekspresja informacji genetycznej Mutacje Podaj i uzasadnij/wyjaśnij Podaj/wymień

Autosomalny gen HTT koduje białko – huntingtynę. Niezmutowany allel h koduje huntingtynę o prawidłowej strukturze, podczas gdy zmutowany allel H skutkuje powstaniem niewłaściwej formy huntingtyny, warunkującej chorobę Huntingtona. Allel H ma charakter dominujący, a obecność nawet tylko jednej jego kopii w genomie jest przyczyną poważnych zaburzeń fizycznych i umysłowych, które powodują śmierć w przeciągu 15–20 lat od wystąpienia objawów.

W genie HTT stosunkowo często pojawia się mutacja polegająca na występowaniu dodatkowych kodonów CAG. Wywołujący chorobę allel H ma więcej niż 35 takich trójek nukleotydów. W większości przypadków objawy choroby rozwijają się między czwartą a szóstą dekadą życia.

Na podstawie: journals.viamedica.pl; www.huntington.pl

18.1. (0–1)

Podaj nazwę rodzaju mutacji genowej występującej w allelu H, polegającej na obecności dodatkowych kodonów CAG.

18.2. (0–1)

Opisz, na czym polega zmiana w I-rzędowej strukturze białka huntingtyny będąca skutkiem obecności dodatkowych kodonów CAG.

18.3. (0–2)

Określ prawdopodobieństwo wystąpienia choroby Huntingtona u dziecka heterozygotycznej matki pod względem genu HTT oraz ojca będącego homozygotą recesywną pod względem tego genu. Odpowiedź uzasadnij, zapisując genotypy rodziców oraz krzyżówkę genetyczną.

Genotyp matki:    Genotyp ojca:

Krzyżówka:

Prawdopodobieństwo wystąpienia choroby Huntingtona:

18.4. (0–1)

Wyjaśnij, dlaczego w populacji ludzkiej utrzymuje się allel H warunkujący chorobę Huntingtona, mimo że jest on dominujący, a choroba – śmiertelna.

Matura Lipiec 2020, Poziom rozszerzony (Formuła 2015)Zadanie 18. (5 pkt)

Dziedziczenie Ekspresja informacji genetycznej Mutacje Ewolucjonizm i historia życia na ziemi Podaj i uzasadnij/wyjaśnij Podaj/wymień

Dystrofia mięśniowa Duchenne'a jest najczęstszą i najcięższą z postępujących dystrofii mięśniowych. Jest to choroba genetycznie uwarunkowana – dziedziczy się w sposób recesywny sprzężony z płcią. Wynikiem obecności nieprawidłowego allelu d genu DMD, jest synteza nieprawidłowej dystrofiny w komórce mięśniowej – białka tworzącego ,,szkielet" komórki mięśniowej. Chorzy umierają zwykle w wieku przedreprodukcyjnym.

Poniżej na schemacie przedstawiono fragment sekwencji nukleotydowej DNA (poszczególne kodony zostały oddzielone przerwami) prawidłowego (I) i zmutowanego genu DMD (II). Zamieszczone fragmenty nie zawierają intronów.

I. Fragment prawidłowej sekwencji nici kodującej:
5’ CAG CAG CAG CAG CAG 3’

II. Fragment sekwencji nici kodującej, w której występuje mutacja:
5’ CAG CAG TAG CAG CAG 3’

18.1. (0–1)

Wpisz, posługując się trójliterowymi skrótami nazw aminokwasów, w wykropkowane miejsca na schemacie sekwencję kodowanego fragmentu białka, zakodowanego w zapisanych fragmentach DNA I i II genu DMD.

18.2. (0–1)

Na podstawie sekwencji I i II genu DMD określ rodzaj mutacji genowej warunkującej rozwój dystrofii mięśniowej Duchenne’a.

18.3. (0–1)

Określ, jakie będą skutki przedstawionej mutacji dla pierwszorzędowej struktury białka, w porównaniu z jego prawidłową strukturą.

18.4. (0–1)

Wyjaśnij, dlaczego mimo działania doboru naturalnego w populacji ludzkiej utrzymuje się allel warunkujący zespół Duchenne’a.

18.5. (0–2)

Określ, jakie jest prawdopodobieństwo, że kolejne dziecko zdrowych rodziców, którzy mają już jednego syna chorego na dystrofię mięśniową typu Duchenne’a, będzie chore na tę chorobę. W odpowiedzi uwzględnij genotypy rodziców oraz zapisz krzyżówkę genetyczną lub obliczenia.

Prawdopodobieństwo, że kolejne dziecko tych rodziców będzie chore: %

Matura Czerwiec 2021, Poziom rozszerzony (Formuła 2015)Zadanie 18. (4 pkt)

Ekspresja informacji genetycznej Mutacje Uzupełnij/narysuj wykres, schemat lub tabelę Podaj/wymień

Na schemacie przedstawiono, w uproszczony sposób, syntezę pewnego peptydu.

Na podstawie: https://en.wikipedia.org/wiki/Ribosomal_pause#/media/File:Peptide_syn.png

18.1. (0–1)

Uzupełnij powyższy schemat.

  1. Wpisz w puste prostokąty odpowiednie oznaczenia (3ʹ lub 5ʹ) obu końców nici cząsteczki mRNA.
  2. Dorysuj do linii grot strzałki wskazującej kierunek odczytu informacji genetycznej.

18.2. (0–1)

Zapisz kodon, oznaczony na schemacie literami XYZ, kodujący metioninę rozpoczynającą ten peptyd, oraz podaj nazwę aminokwasu oznaczonego na schemacie literą α, który jako kolejny zostanie dołączony do syntezowanego peptydu.

  1. Kodon XYZ:
  2. Aminokwas α:

18.3. (0–1)

Określ, z ilu aminokwasów będzie ostatecznie zbudowany ten peptyd, jeżeli po translacji metionina zostanie odcięta.

Liczba aminokwasów budujących peptyd:

18.4. (0–1)

We fragmencie DNA, w którym jest zapisana sekwencja aminokwasowa przedstawionego peptydu, doszło w nici kodującej do podstawienia adeniny na guaninę w trzeciej pozycji kodonu kodującego lizynę.

Określ skutek tej mutacji na poziomie sekwencji aminokwasowej peptydu.

Informator CKE, Poziom rozszerzony (Formuła 2023)Zadanie 14. (8 pkt)

Układ immunologiczny Choroby człowieka Ekspresja informacji genetycznej Metody badawcze i doświadczenia Uzupełnij/narysuj wykres, schemat lub tabelę Zamknięte (np. testowe, prawda/fałsz) Podaj i uzasadnij/wyjaśnij

Współcześnie stosuje się dwie podstawowe metody wykrywania zakażeń HIV. Rutynowe badanie polega na wykrywaniu przeciwciał anty-HIV w surowicy pacjenta. W przypadku tej metody czułość badania, czyli prawdopodobieństwo otrzymania wyniku dodatniego u osoby chorej, tzn. wykrycia zakażenia, wynosi 100%, ale wynik dodatni otrzymuje się także dla 0,5% zdrowych osób – specyficzność wynosi 99,5%. Dlatego postawienie diagnozy zakażenia HIV wymaga potwierdzenia dodatkowym badaniem za pomocą metody PCR, wykrywającym gen odwrotnej transkryptazy wbudowany w genom gospodarza. Ta metoda jest teoretycznie bezbłędna pod warunkiem utrzymywania wysokich standardów pracy laboratoryjnej. Odpowiednie próby kontrolne służą sprawdzeniu, czy:

  • polimeraza DNA nie utraciła aktywności podczas przechowywania (kontrola pozytywna),
  • wszystkie odczynniki są wolne od wirusowego materiału genetycznego (kontrola negatywna).

Dla trzech pacjentów uzyskano dodatni wynik testu na obecność przeciwciał anty-HIV. Z tego powodu lekarz zlecił dodatkowe badanie z wykorzystaniem metody PCR, którego wyniki podsumowano w poniższej tabeli.

Próba
badawcza kontrolna pozytywna kontrolna negatywna
Pacjent 1. +
Pacjent 2. + + +
Pacjent 3. + +
Na podstawie: GenBank sekwencja nr KR861191.1;
M. Fearon, The Laboratory Diagnosis of HIV Infections, „Can J Dis Med Microbiol” 16, 2005, s. 26–30;
D.S Boyle i inni, Rapid Detection of HIV-1 Proviral DNA for Early Infant Diagnosis Using Recombinase Polymerase Amplification, „mBio” 4, 2013, e00135–13;
S. Koblavi-Dème i inni, Sensitivity and Specificity of Human Immunodeficiency Virus Rapid Serologic Assays and Testing Algorithms in an Antenatal Clinic in Abidjan, Ivory Coast, „J Clin Microbiol” 39, 2001, s. 1808–1812.

14.1. (0–2)

Zaprojektuj doświadczenie PCR wykrywające DNA HIV wbudowane w genom gospodarza. Dla każdej z prób – badawczej, kontrolnej pozytywnej i kontrolnej negatywnej – wybierz wszystkie właściwe składniki mieszaniny reakcyjnej. Wpisz w tabelę znak „+”, jeśli składnik należy dodać do próby, albo znak „–”, jeśli ten składnik należy pominąć.

Próba
badawcza kontrolna pozytywna kontrolna negatywna
DNA genomowy wyizolowany od pacjenta
DNA genomowy wyizolowany z linii komórkowej zakażonej HIV
para specyficznych starterów
bufor zapewniający optymalne pH i stężenie jonów Mg2+
termostabilna polimeraza DNA
mieszanina deoksyrybonukleotydów

14.2. (0–1)

Wybierz spośród A–D i zaznacz prawidłowe sekwencje starterów polF1 i polR1, wykorzystywanych w teście diagnostycznym HIV, przyłączających się do zaznaczonych fragmentów poniższej sekwencji genu odwrotnej transkryptazy wirusa HIV, wbudowanej w genom gospodarza.

  1. polF1 5′ CCCTACAATCCCCAAAGTCAAGGAGTAGTAGAA 3′
    polR1 5′ CTCTGGAAAGGTGAAGGGGCAGTAGTAATACA 3′
  2. polF1 5′ TTCTACTACTCCTTGACTTTGGGGATTGTAGGG 3′
    polR1 5′ TGTATTACTACTGCCCCTTCACCTTTCCAGAG 3′
  3. polF1 5′ CCCTACAATCCCCAAAGTCAAGGAGTAGTAGAA 3′
    polR1 5′ TGTATTACTACTGCCCCTTCACCTTTCCAGAG 3′
  4. polF1 5′ TTCTACTACTCCTTGACTTTGGGGATTGTAGGG 3′
    polR1 5′ CTCTGGAAAGGTGAAGGGGCAGTAGTAATACA 3′

14.3. (0–2)

Podpunkt anulowany przez CKE

Przed zabiegiem chirurgicznym pacjentowi wykonano testy na nosicielstwo wirusa HIV wykrywające przeciwciała anty-HIV. Wynik wyszedł dodatni. Pacjent nie znajduje się w żadnej z grup ryzyka zakażenia HIV. Według oficjalnych danych częstość występowania zakażenia HIV w Polsce wynosi ok. 40 osób na 100 tys.

Oblicz prawdopodobieństwo, że pacjent jest zakażony HIV, z uwzględnieniem czułości i specyficzności testu na przeciwciała anty-HIV. Zapisz obliczenia w wyznaczonych miejscach 1.–3.

  1. Oczekiwana liczba osób zakażonych HIV, u których wynik testu na przeciwciała anty-HIV będzie dodatni, wśród 100 tys. losowo przebadanych osób:
  2. Oczekiwana liczba osób zdrowych (niezakażonych), u których wynik testu na przeciwciała anty-HIV będzie dodatni, wśród 100 tys. losowo przebadanych osób:
  3. Prawdopodobieństwo, że pacjent z dodatnim wynikiem testu na przeciwciała anty-HIV jest zakażony HIV:

14.4. (0–1)

Oceń, czy poniższe interpretacje przedstawionych wyników badań trojga pacjentów są prawidłowe. Zaznacz T (tak), jeśli interpretacja jest prawidłowa, albo N (nie) – jeśli jest nieprawidłowa.

1. U pacjenta 1. wynik testu na przeciwciała anty-HIV był fałszywie dodatni, o czym świadczy wykluczenie zakażenia na podstawie wyników PCR. T N
2. Wyniki testu PCR dla pacjenta 2. są niewiarygodne ze względu na dodatni wynik w próbie kontrolnej negatywnej – należy powtórzyć badanie. T N
3. Dodatkowe badanie techniką PCR potwierdziło podejrzenie, że pacjent 3. jest zakażony HIV. T N

14.5. (0–1)

Wyjaśnij, dlaczego testy wykrywające przeciwciała anty-HIV nie nadają się do diagnostyki zakażeń HIV u noworodków i niemowląt urodzonych przez matki zakażone HIV. W odpowiedzi uwzględnij spodziewany wynik testu oraz funkcjonowanie układu odpornościowego matki.

14.6. (0–1)

Oceń, czy poniższe osoby znajdują się w grupie zwiększonego ryzyka zakażenia HIV. Zaznacz T (tak), jeśli się w niej znajdują, albo N (nie) – jeśli w niej się nie znajdują.

1. Osoby przebywające w jednym pomieszczeniu z osobami zakażonymi HIV, np. w pracy lub szkole. T N
2. Osoby narażone na częste ukąszenia komarów i innych owadów odżywiających się krwią. T N
3. Sąsiedzi osób zakażonych HIV, mieszkający w tym samym domu wielorodzinnym. T N

Informator CKE, Poziom rozszerzony (Formuła 2023)Zadanie 12. (2 pkt)

Ekspresja informacji genetycznej Zamknięte (np. testowe, prawda/fałsz)

Uzupełnij poniższe zdania tak, aby powstał poprawny opis zjawiska alternatywnego składania eksonów. W każdym nawiasie podkreśl właściwe określenie.

W wyniku alternatywnego składania eksonów może powstać (tylko jeden rodzaj / wiele rodzajów) mRNA. Dzięki temu w organizmach eukariotycznych obserwuje się znacznie (mniej / więcej) różnych białek w porównaniu z liczbą genów w genomie. Ze względu na to, że ten proces nie zachodzi w organizmach prokariotycznych, gdy planuje się otrzymanie eukariotycznego białka w komórkach bakterii, należy przeprowadzić odwrotną (transkrypcję / translację) mRNA, która pozwala uzyskać gen pozbawiony (eksonów / intronów).

Biomedica 2022, Poziom rozszerzony (Formuła 2015)Zadanie 26. (3 pkt)

Skład organizmów Ekspresja informacji genetycznej Podaj i uzasadnij/wyjaśnij Podaj/wymień

Poniżej przedstawiono schemat budowy polirybosomu.

26.1. (0–1)

Podaj, z jakiego rodzaju RNA zbudowane są rybosomy.

26.2. (0–1)

Wyjaśnij, jakie znaczenie dla efektywności pracy komórki ma występowanie polirybosomów.

26.3. (0–1)

Podaj, jak nazywa się proces zachodzący na polirybosomie.

To zadanie pochodzi ze zbioru matura 2022 wydawnictwa Biomedica
Kup pełny zbiór zadań

Informator CKE, Poziom rozszerzony (Formuła 2023)Zadanie 1. (4 pkt)

Skład organizmów Budowa i funkcje komórki Układ immunologiczny Ekspresja informacji genetycznej Zamknięte (np. testowe, prawda/fałsz) Podaj i uzasadnij/wyjaśnij

U ssaków przeciwciała produkowane przez matkę mogą zostać przekazane potomstwu nie tylko w czasie życia płodowego, lecz także po urodzeniu. Zawarte w mleku matki przeciwciała klasy IgG mogą przedostać się przez nabłonek jelita do krwiobiegu niemowlęcia, ale przeciwciała klasy IgA są wchłaniane do enterocytów tylko w niewielkim stopniu, gdzie są następnie trawione.

Selektywny transport przeciwciał umożliwia białko FcRn, składające się z dwóch niekowalencyjnie związanych łańcuchów: ciężkiego H oraz lekkiego L. Przechodzi ono modyfikacje potranslacyjne – do co najmniej jednego aminokwasu są dołączane reszty cukrowe. Białko FcRn pełni funkcję receptora na powierzchni błony enterocytu, a jego powinowactwo do przeciwciał jest zależne od pH środowiska. U młodych ssaków treść dwunastnicy i jelita czczego ma kwaśny odczyn, a więc niższy niż fizjologiczne pH krwi. Transport przeciwciał zilustrowano na poniższym schemacie.

Na podstawie: M. Pyzik i inni, The Architect Behind the Immune and Nonimmune Functions of IgG and Albumin, „Journal of Immunlogy” 194, 2015, s. 4595–4603.

1.1. (0–1)

Wybierz i zaznacz makroelement, który może wejść w skład białka wyłącznie w wyniku modyfikacji potranslacyjnej.

  1. węgiel
  2. wodór
  3. azot
  4. tlen
  5. fosfor
  6. siarka

1.2. (0–1)

Na podstawie przedstawionych we wstępie do zadania informacji określ najwyższą rzędowość struktury białka FcRn. Odpowiedź uzasadnij, odwołując się do cechy budowy tego białka.

1.3. (0–1)

Uzupełnij poniższe zdanie tak, aby powstał poprawny opis transportu przeciwciał przez komórkę nabłonka jelita z mleka matki do krwiobiegu niemowlęcia. W każdym nawiasie podkreśl właściwe określenie.

Przeciwciała dostają się z treści jelita niemowlęcia do wnętrza enterocytu na zasadzie (dyfuzji wspomaganej / endocytozy), a następnie wydostają się z niego do jego krwiobiegu w procesie (dyfuzji prostej / egzocytozy).

1.4. (0–1)

Wyjaśnij, dlaczego przez barierę jelitową do krwiobiegu niemowlęcia przedostają się wyłącznie przeciwciała klasy IgG, mimo że w mleku matki są zawarte także przeciwciała klasy IgA. W odpowiedzi uwzględnij rolę białka FcRn.

Matura Maj 2021, Poziom rozszerzony (Formuła 2015)Zadanie 19. (5 pkt)

Układ krążenia Choroby człowieka Dziedziczenie Ekspresja informacji genetycznej Zamknięte (np. testowe, prawda/fałsz) Podaj i uzasadnij/wyjaśnij Podaj/wymień

W strukturze genu obok fragmentów kodujących (eksonów) mogą występować elementy niekodujące, takie jak promotor lub introny.

W poniższej tabeli przedstawiono informacje na temat sześciu wybranych genów człowieka, oznaczonych numerami 1.–6., kodujących określone białka.

Oznaczenie genu Kodowane białko Oznaczenie chromosomu Wielkość genu (kpz DNA) Wielkość mRNA (kz)
1. α-globina 16 0,8 0,5
2. albumina 4 25,0 2,1
3. receptor LDL 19 45,0 5,5
4. kinaza zależna od cyklin 4 54,0 1,7
5. hydroksylaza fenyloalaninowa 12 90,0 2,4
6. dystrofina X 2000,0 16,0

kpz – tysiąc par zasad
kz – tysiąc zasad

Na podstawie: red. J. Bal, Biologia molekularna w medycynie, Warszawa 2013;
https://ghr.nlm.nih.gov/gene;
https://www.ncbi.nlm.nih.gov.

19.1. (0–1)

Podaj nazwę procesu, którego produktem jest pre-mRNA, oraz określ lokalizację tego procesu w komórce człowieka.

Nazwa procesu:
Lokalizacja procesu:

19.2. (0–1)

Wyjaśnij, z czego wynikają różnice między wielkościami genów a wielkościami cząsteczek mRNA, które im odpowiadają.

19.3. (0–1)

Podaj nazwę choroby, u podłoża której leży mutacja genu kodującego hydroksylazę fenyloalaninową, prowadząca do utraty funkcji tego enzymu niezbędnego w metabolizmie fenyloalaniny.

19.4. (0–1)

Spośród wymienionych w tabeli wybierz i zapisz oznaczenia pary genów, które mogą dziedziczyć się niezgodnie z II prawem Mendla. Odpowiedź uzasadnij, odwołując się do treści tego prawa oraz do lokalizacji wybranych genów w genomie.

19.5. (0–1)

Uzupełnij poniższe zdania tak, aby powstał poprawny opis dotyczący albumin. Podkreśl w każdym nawiasie właściwe określenie.

Albuminy to białka (rozpuszczalne / nierozpuszczalne) w wodzie, występujące głównie (w cytoplazmie erytrocytów / w osoczu krwi). Główną funkcją tych białek jest (transport tlenu / regulacja ciśnienia osmotycznego krwi).

Matura Maj 2021, Poziom rozszerzony (Formuła 2015)Zadanie 1. (3 pkt)

Skład organizmów Ekspresja informacji genetycznej Podaj i uzasadnij/wyjaśnij Podaj/wymień

Prolaktyna, wydzielana przez gruczołową część przysadki mózgowej, jest jednołańcuchowym polipeptydem złożonym ze 199 aminokwasów, powstającym w wyniku odcięcia peptydu sygnałowego liczącego 28 aminokwasów. Na poniższym schemacie przedstawiono strukturę przestrzenną cząsteczki dojrzałej ludzkiej prolaktyny.

Na podstawie: S.J. Konturek, Fizjologia człowieka, Wrocław 2013;
Protein Data Bank, https://www.rcsb.org/structure/1RW5.

1.1. (0–1)

Określ dominującą strukturę II-rzędową w cząsteczce dojrzałej ludzkiej prolaktyny.

1.2. (0–1)

Na podstawie przedstawionych informacji określ najwyższą rzędowość struktury białka – prolaktyny. Odpowiedź uzasadnij, odwołując się do cech budowy tego białka.

1.3. (0–1)

Podaj całkowitą liczbę kodonów w mRNA stanowiącym matrycę podczas syntezy prolaktyny.

Matura Marzec 2021, Poziom rozszerzony (Formuła 2015)Zadanie 2. (5 pkt)

Budowa i funkcje komórki Ekspresja informacji genetycznej Zamknięte (np. testowe, prawda/fałsz) Podaj/wymień

Na poniższym rysunku przedstawiono jeden z etapów translacji. Literami: E, P i A zaznaczono trzy miejsca funkcyjne rybosomu.

https://pl.khanacademy.org

2.1. (0–1)

Podaj nazwę aminokwasu oznaczonego na rysunku literą X.

Nazwa aminokwasu:

2.2. (0–1)

Oceń czy poniższe stwierdzenia dotyczące rybosomów w komórkach eukariotycznych są prawdziwe. Zaznacz P, jeśli stwierdzenie jest prawdziwe, albo F – jeśli jest fałszywe.

1. Funkcjonalny rybosom w komórce eukariotycznej składa się z dwóch podjednostek: małej i dużej, które są zbudowane z białek i rRNA. P F
2. Wszystkie rybosomy w komórce eukariotycznej są jednakowej wielkości i pełnią te same funkcje. P F
3. W komórkach eukariotycznych białka produkowane na eksport powstają na rybosomach związanych z siateczką śródplazmatyczną. P F

2.3. (0–2)

Do funkcji rybosomu 1.–4., pełnionych podczas translacji przez poszczególne miejsca funkcyjne rybosomu, przyporządkuj ze schematu ich odpowiednie oznaczenia wybrane spośród: E, P lub A.

  1. Przyłączanie inicjatorowego tRNA rozpoczynającego translację:
  2. Wiązanie aminoacylo-tRNA:
  3. Wiązanie peptydylo-tRNA:
  4. Uwalnianie z rybosomu wolnego tRNA:

2.4. (0–1)

Uzupełnij poniższe zdania tak, aby zawierały one prawdziwe informacje dotyczące translacji. Podkreśl w każdym nawiasie właściwe określenie.

Do połączenia podjednostek rybosomu dochodzi tylko w przypadku przyłączenia do (małej / dużej) podjednostki odpowiedniego rodzaju kwasu nukleinowego – (tRNA / końca 3ʹ mRNA / końca 5ʹ mRNA). Zachodzi wtedy proces (inicjacji / elongacji / terminacji) translacji.

Matura Maj 2020, Poziom podstawowy (Formuła 2007)Zadanie 19. (2 pkt)

Ekspresja informacji genetycznej Podaj i uzasadnij/wyjaśnij

Kod genetyczny to reguła, według której informacja genetyczna zapisana w sekwencji nukleotydów jest tłumaczona na sekwencję aminokwasów w białku. Jedną z cech kodu genetycznego jest możliwość zapisania jednego aminokwasu za pomocą różnych kodonów.

a)Określ, na którym etapie ekspresji informacji genetycznej – transkrypcji czy translacji – komórka bezpośrednio wykorzystuje kod genetyczny. Odpowiedź uzasadnij.
b)Podaj nazwę cechy kodu genetycznego opisanej w tekście i wykaż jej znaczenie dla zmniejszenia szkodliwych skutków mutacji zachodzących w materiale genetycznym.

Matura Maj 2020, Poziom rozszerzony (Formuła 2007)Zadanie 22. (2 pkt)

Budowa i funkcje komórki Ekspresja informacji genetycznej Podaj/wymień Podaj i uzasadnij/wyjaśnij

Na rysunku przedstawiono etapy pewnego procesu zachodzącego z udziałem siateczki śródplazmatycznej. Ten proces wymaga rozpoznawania sekwencji sygnałowej przez cząstki rozpoznające sygnał (SRP).

Na podstawie: P.C. Turner, A.G. McLennan, Krótkie wykłady. Biologia molekularna, Warszawa 2002.

a)Podaj nazwę i określ funkcję związku chemicznego oznaczonego na rysunku literą X.

Nazwa związku X:
Funkcja:

b)Określ, czy proces zilustrowany na rysunku zachodzi w organizmach prokariotycznych, czy – w eukariotycznych. Odpowiedź uzasadnij.

Matura Maj 2020, Poziom rozszerzony (Formuła 2007)Zadanie 21. (2 pkt)

Prokarionty Ekspresja informacji genetycznej Podaj i uzasadnij/wyjaśnij Zamknięte (np. testowe, prawda/fałsz)

Na schematach A i B przedstawiono jeden z mechanizmów regulacji ekspresji genów u bakterii. Przedstawiają one różny sposób działania represora, zależnie od obecności związku X.

Na podstawie: J. Kączkowski, Biochemia roślin, Warszawa 1992.

a)Na podstawie schematu B opisz, w jaki sposób związek chemiczny X wpływa na ekspresję genów struktury u bakterii.
b)Wybierz spośród A–D i zaznacz właściwe dokończenie zdania.

Regulacja ekspresji genów u eukariontów

  1. ma taki sam przebieg jak u bakterii.
  2. odbywa się tylko na poziomie replikacji i transkrypcji.
  3. odbywa się na wielu różnych poziomach.
  4. jest możliwa dzięki wytworzeniu chromosomów.

Zbiór zadań CKE, Poziom rozszerzony (Formuła 2015)Zadanie 100. (4 pkt)

Choroby człowieka Ekspresja informacji genetycznej Mutacje Podaj i uzasadnij/wyjaśnij Podaj/wymień

Na rysunku przedstawiono fragment genu oraz fragment powstałego na jego podstawie mRNA, a następnie fragment zsyntetyzowanego polipeptydu przed mutacją oraz po mutacji.

Na podstawie: L.B. Jorde, J.C. Carey, M.J. Bamshad, Genetyka medyczna, Wrocław 2014, s. 27.

a)Wyjaśnij, na czym polega przedstawiony rodzaj mutacji, uwzględniając najpierw sekwencję nukleotydów w genie, a następnie przebieg i wynik procesu ekspresji informacji genetycznej zawartej w tym genie.
b)Przyjmując, że na DNA nie działały czynniki mutagenne, podaj typową przyczynę powstawania takich mutacji, jak zilustrowana na schemacie.
c)Korzystając z tabeli kodu genetycznego (zamieszczonego w zestawie Wybranych wzorów i stałych fizykochemicznych na egzamin maturalny z biologii, chemii i fizyki), odczytaj, które trzy aminokwasy zostaną wbudowane do polipeptydu po zajściu tej mutacji i wpisz w wykropkowane miejsca skróty ich nazw.
d)Spośród wymienionych niżej chorób człowieka wybierz i podkreśl tę, której przyczyną może być przedstawiony typ mutacji.

Nazwy chorób: miażdżyca, mukowiscydoza, anemia złośliwa, zespół Klinefeltera, cukrzyca, zespół Turnera.

Zbiór zadań CKE, Poziom rozszerzony (Formuła 2015)Zadanie 99. (3 pkt)

Skład organizmów Ekspresja informacji genetycznej Zamknięte (np. testowe, prawda/fałsz) Podaj/wymień

Na rysunku przedstawiono główne etapy ekspresji informacji genetycznej.

Na podstawie: E.P. Solomon, L.R. Berg, D.W. Martin, C.A. Ville, Biologia. Warszawa 1996, s. 279.

a)Korzystając z informacji podanych na rysunku i własnej wiedzy, oceń prawdziwość poniższych stwierdzeń. Wpisz znak X w odpowiednie komórki tabeli.
Lp. Informacja Prawda Fałsz
1. Każda z nici DNA oraz nić mRNA zbudowane są z podobnych podjednostek chemicznych połączonych ze sobą za pomocą takich samych wiązań kowalencyjnych.
2. Dwuniciowy DNA oraz mRNA zbudowane są z nukleotydów purynowych i pirymidynowych, a stosunek ilościowy tych nukleotydów w obu kwasach wynosi 1 : 1.
3. Strukturę przestrzenną DNA i mRNA stabilizują wiązania wodorowe pomiędzy komplementarnymi zasadami azotowymi nukleotydów.
b)Stosując oznaczenia literowe zasad azotowych, podaj kodon 2 i kodon 3 w mRNA oraz w nici matrycowej DNA.
c)Zaznacz prawidłowe dokończenie zdania.

Na podstawie przedstawionego schematu ekspresji informacji genetycznej można stwierdzić, że

  1. podczas transkrypcji trójkowy kod genetyczny ulega rozszyfrowaniu.
  2. podczas translacji dany kodon znajdujący się w DNA zostaje odczytany dwa razy.
  3. podczas transkrypcji – mimo zmiany zapisu informacji genetycznej – nie zmienia się jej sens.
  4. zmiana nukleotydu w danym kodonie powoduje zmianę jednego aminokwasu w białku.

Zbiór zadań CKE, Poziom rozszerzony (Formuła 2015)Zadanie 95. (1 pkt)

Ekspresja informacji genetycznej Podaj i uzasadnij/wyjaśnij

W komórkach E. coli operon laktozowy (lac) zawiera geny struktury kodujące enzymy niezbędne do rozkładu laktozy i jej pobierania ze środowiska zewnętrznego. Transkrypcja tych genów zależy od warunków środowiska. Jeżeli w środowisku bakterii nie ma laktozy, to represor lac – specjalne (allosteryczne) białko – wiąże się z operatorem, uniemożliwiając przyłączenie do promotora polimerazy RNA i rozpoczęcie transkrypcji genów struktury.
Na rysunku przedstawiono operon laktozowy (I) oraz wpływ laktozy (induktora) na aktywność represora (II).

Na podstawie: Podstawy genetyki dla studentów i lekarzy, red. G. Drewa,T. Ferenc, Wrocław 2005, s. 94.

Korzystając z rysunku, opisz sposób, w jaki laktoza pobrana przez komórkę z podłoża wpływa na represor lac. Określ konsekwencje tego wpływu dla komórki i jej procesu oddychania.

Zbiór zadań CKE, Poziom rozszerzony (Formuła 2015)Zadanie 84. (4 pkt)

Ekspresja informacji genetycznej Ewolucjonizm i historia życia na ziemi Mutacje Podaj i uzasadnij/wyjaśnij

Poniżej zilustrowano mutację, która jest przyczyną mukowiscydozy – choroby genetycznej autosomalnej recesywnej, upośledzającej funkcjonowanie płuc, trzustki i innych narządów. Ocenia się, że w populacji europejskiej choruje 1 na 2500 osób.

ALLEL PRAWIDŁOWY
Numer kodonu
Łańcuch DNA
Aminokwasy
 
503
ATC
Ile
 
507
ATC
Ile
 
508
TTT
Phe
 
509
GGT
Gly
 
510
GGT
Val
ALLEL ZMUTOWANY
Numer kodonu
Łańcuch DNA
Aminokwasy
 
506
ATC
Ile
 
507
AT-
Ile
 
508
--T
 
 
509
GGT
Gly
 
510
GGT
Val

Na podstawie: K.M. Charon, M. Świtoński, Genetyka zwierząt, Warszawa 2000, s. 121.

a)Korzystając z tabeli kodu genetycznego określ, czy przedstawiony fragment łańcucha DNA jest nicią kodującą, czy matrycową. Uzasadnij odpowiedź.
b)Uzasadnij na podstawie podanej informacji, że kod genetyczny jest zdegenerowany.
c)Podaj nazwę przedstawionego rodzaju mutacji genowej i określ skutek tej mutacji dla struktury I-rzędowej powstającego białka.
d)Oblicz, korzystając z równań Hardy’ego-Weinberga, częstość występowania nosicieli allelu mukowiscydozy w populacji europejskiej.

Strony