Genetyka

Oto lista zadań maturalnych z danego działu biologii. Aby skorzystać z dodatkowych opcji lub wybrać zadania z pozostałych działów kliknij poniżej.

Przejdź do wyszukiwarki zadań

 

Matura Lipiec 2020, Poziom rozszerzony (Formuła 2015)Zadanie 19. (5 pkt)

Dziedziczenie Choroby człowieka Genetyka - pozostałe Ewolucjonizm i historia życia na ziemi Podaj i uzasadnij/wyjaśnij Zamknięte (np. testowe, prawda/fałsz)

Adermatoglifia to bardzo rzadkie zaburzenie genetyczne. Powoduje ono, że dana osoba nie ma linii papilarnych, a więc nie pozostawia charakterystycznych odcisków palców. Poza tym osoby z adermatoglifią są całkowicie zdrowe, w niewielkim stopniu zredukowana jest tylko u nich liczba gruczołów potowych.

Przyczyną adermatoglifii jest mutacja genu SMARCAD1, który ma swój locus w czwartym chromosomie. Ta mutacja jest substytucją, która zaburza splicing (składanie genu) i uniemożliwia syntezę prawidłowego białka niezbędnego do wytworzenia linii papilarnych. Pomimo że do wystąpienia adermatoglifii wystarczy jeden zmutowany allel, stwierdzono ją dotychczas tylko w kilku rodzinach na świecie.

Inną przyczyną braku linii papilarnych jest mutacja genu KTR14. Efektem tej mutacji jest choroba DPR (łac. dermatopathia pigmentosa reticularis). Osoby dotknięte DPR, oprócz braku linii papilarnych, charakteryzują się cieńszymi i łamliwymi włosami, oraz nierówną pigmentacją skóry.

Na podstawie: http://www.omim.org/entry;
https://ghr.nlm.nih.gov/condition/adermatoglyphia.

19.1. (0–1)

Zaznacz poprawne dokończenie poniższego zdania – wybierz odpowiedź spośród A–B oraz odpowiedź spośród 1.–2.

Allel wywołujący adermatoglifię, w stosunku do allelu niepowodującego tego zaburzenia, jest

A. dominujący, a ta choroba występuje u kobiet i mężczyzn 1. z taką samą częstością.
B. recesywny, 2. z różną częstością.

19.2. (0–1)

Wyjaśnij, dlaczego w przypadku adermatoglifii, w odróżnieniu od DPR, mówi się raczej o zaburzeniu genetycznym, a nie – o chorobie genetycznej. W odpowiedzi odwołaj się do efektów fenotypowych.

19.3. (0–1)

Określ, który z genów – gen warunkujący adermatoglifię czy gen warunkujący DPR – ma silniejszy efekt plejotropowy. Odpowiedź uzasadnij.

19.4. (0–1)

Oceń, czy poniższe stwierdzenia dotyczące adermatoglifii są prawdziwe. Zaznacz P, jeśli stwierdzenie jest prawdziwe, albo F – jeśli jest fałszywe.

1. W adermatoglifii zaburzony jest proces wycinania intronów. P F
2. Adermatoglifia jest spowodowana mutacją punktową. P F
3. Mężczyźni mogą być bezobjawowymi nosicielami allelu adermatoglifii. P F

19.5. (0–1)

Określ, jakie znaczenie adaptacyjne miało w toku ewolucji pojawienie się u naczelnych linii papilarnych na wewnętrznych powierzchniach dłoni i stóp.

Matura Lipiec 2020, Poziom rozszerzony (Formuła 2015)Zadanie 18. (5 pkt)

Dziedziczenie Ekspresja informacji genetycznej Genetyka - pozostałe Ewolucjonizm i historia życia na ziemi Podaj i uzasadnij/wyjaśnij Podaj/wymień

Dystrofia mięśniowa Duchenne'a jest najczęstszą i najcięższą z postępujących dystrofii mięśniowych. Jest to choroba genetycznie uwarunkowana – dziedziczy się w sposób recesywny sprzężony z płcią. Wynikiem obecności nieprawidłowego allelu d genu DMD, jest synteza nieprawidłowej dystrofiny w komórce mięśniowej – białka tworzącego ,,szkielet" komórki mięśniowej. Chorzy umierają zwykle w wieku przedreprodukcyjnym.

Poniżej na schemacie przedstawiono fragment sekwencji nukleotydowej DNA (poszczególne kodony zostały oddzielone przerwami) prawidłowego (I) i zmutowanego genu DMD (II). Zamieszczone fragmenty nie zawierają intronów.

I. Fragment prawidłowej sekwencji nici kodującej:
5’ CAG CAG CAG CAG CAG 3’

II. Fragment sekwencji nici kodującej, w której występuje mutacja:
5’ CAG CAG TAG CAG CAG 3’

18.1. (0–1)

Wpisz, posługując się trójliterowymi skrótami nazw aminokwasów, w wykropkowane miejsca na schemacie sekwencję kodowanego fragmentu białka, zakodowanego w zapisanych fragmentach DNA I i II genu DMD.

18.2. (0–1)

Na podstawie sekwencji I i II genu DMD określ rodzaj mutacji genowej warunkującej rozwój dystrofii mięśniowej Duchenne’a.

18.3. (0–1)

Określ, jakie będą skutki przedstawionej mutacji dla pierwszorzędowej struktury białka, w porównaniu z jego prawidłową strukturą.

18.4. (0–1)

Wyjaśnij, dlaczego mimo działania doboru naturalnego w populacji ludzkiej utrzymuje się allel warunkujący zespół Duchenne’a.

18.5. (0–2)

Określ, jakie jest prawdopodobieństwo, że kolejne dziecko zdrowych rodziców, którzy mają już jednego syna chorego na dystrofię mięśniową typu Duchenne’a, będzie chore na tę chorobę. W odpowiedzi uwzględnij genotypy rodziców oraz zapisz krzyżówkę genetyczną lub obliczenia.

Prawdopodobieństwo, że kolejne dziecko tych rodziców będzie chore: %

Matura Lipiec 2020, Poziom rozszerzony (Formuła 2015)Zadanie 5. (6 pkt)

Prokarionty Wirusy, wiroidy, priony Ewolucjonizm i historia życia na ziemi Inżynieria i badania genetyczne Podaj i uzasadnij/wyjaśnij Podaj/wymień

Transfer materiału genetycznego (DNA) między komórkami bakterii odbywa się na drodze koniugacji, transdukcji lub transformacji:

  • koniugacja – polega na jednokierunkowym transferze plazmidowego DNA z jednej komórki bakteryjnej do drugiej;
  • transdukcja – zachodzi z udziałem wirusów;
  • transformacja – polega na pobieraniu przez bakterie materiału genetycznego ze środowiska.
Na podstawie: U. Kasprzykowska, M. Sobieszczańska, Plastyczność bakteryjnych genomów – międzykomórkowy transfer informacji genetycznej, „ Postępy mikrobiologii”, 53 (2) 2014.

5.1. (0–1)

Uporządkuj przedstawione poniżej etapy koniugacji bakterii (A– E) w kolejności ilustrującej przebieg tego procesu.

Kolejność:

5.2. (0–1)

Uzasadnij, że do przekazania informacji genetycznej zapisanej w plazmidzie, na drodze koniugacji, wystarczy przeniesienie do komórki – biorcy tylko jednej nici DNA plazmidowego.

5.3. (0–1)

Uzasadnij, że bakteria, która jest biorcą DNA plazmidowego w procesie koniugacji, może odnieść korzyści z tego procesu. W odpowiedzi uwzględnij przykład takiej korzyści.

5.4. (0–1)

Uzasadnij, że bakteriofagi mogą być wektorami przenoszącymi DNA pomiędzy komórkami bakterii.

5.5. (0–1)

Wyjaśnij, dlaczego intensywna międzykomórkowa wymiana informacji genetycznej zachodząca w populacji bakterii zapewnia tym mikroorganizmom bardzo szybkie tempo ewolucji adaptacyjnej.

5.6. (0–1)

Do podanych w tabeli cech wektora plazmidowego 1.–3., wykorzystywanego przy wprowadzaniu obcego DNA do komórek bakterii, przyporządkuj spośród A–D po jednym jego znaczeniu w tym procesie.

  1. Umożliwia rozdzielenie wektorów do komórek potomnych.
  2. Umożliwia selekcję szczepów, które pobrały plazmid.
  3. Umożliwia włączenie obcego DNA do wektora plazmidowego.
  4. Ułatwia miejscowe rozplecenie helisy DNA.
Cecha wektora plazmidowego Znaczenie podczas wprowadzania DNA do bakterii
1. Miejsce inicjacji replikacji bogate w pary AT, a nie – w pary CG.
2. Obecność fragmentu z wieloma miejscami rozpoznawalnymi przez enzymy restrykcyjne.
3. Obecność genu oporności na określony antybiotyk.

Matura Czerwiec 2021, Poziom rozszerzony (Formuła 2015)Zadanie 18. (4 pkt)

Ekspresja informacji genetycznej Uzupełnij/narysuj wykres, schemat lub tabelę Podaj/wymień

Na schemacie przedstawiono, w uproszczony sposób, syntezę pewnego peptydu.

Na podstawie: https://en.wikipedia.org/wiki/Ribosomal_pause#/media/File:Peptide_syn.png

18.1. (0–1)

Uzupełnij powyższy schemat.

  1. Wpisz w puste prostokąty odpowiednie oznaczenia (3ʹ lub 5ʹ) obu końców nici cząsteczki mRNA.
  2. Dorysuj do linii grot strzałki wskazującej kierunek odczytu informacji genetycznej.

18.2. (0–1)

Zapisz kodon, oznaczony na schemacie literami XYZ, kodujący metioninę rozpoczynającą ten peptyd, oraz podaj nazwę aminokwasu oznaczonego na schemacie literą α, który jako kolejny zostanie dołączony do syntezowanego peptydu.

  1. Kodon XYZ:
  2. Aminokwas α:

18.3. (0–1)

Określ, z ilu aminokwasów będzie ostatecznie zbudowany ten peptyd, jeżeli po translacji metionina zostanie odcięta.

Liczba aminokwasów budujących peptyd:

18.4. (0–1)

We fragmencie DNA, w którym jest zapisana sekwencja aminokwasowa przedstawionego peptydu, doszło w nici kodującej do podstawienia adeniny na guaninę w trzeciej pozycji kodonu kodującego lizynę.

Określ skutek tej mutacji na poziomie sekwencji aminokwasowej peptydu.

Matura Czerwiec 2021, Poziom rozszerzony (Formuła 2015)Zadanie 16. (4 pkt)

Dziedziczenie Podaj/wymień Podaj i uzasadnij/wyjaśnij

Za barwę upierzenia papużek falistych odpowiadają allele dwóch dopełniających się genów autosomalnych, które dziedziczą się niezależnie. Dominujący allel F warunkuje kolor niebieski, natomiast allel G – kolor żółty. Papużki mające co najmniej po jednym allelu dominującym obydwu genów są zielone, natomiast osobniki będące podwójnymi homozygotami recesywnymi są białe.

Potomstwo pary papużek falistych – niebieskiej i żółtej – było zawsze upierzone zielono. Jednak kiedy krzyżowano te zielone ptaki z F1 z innymi osobnikami zielonymi, otrzymywano w F2 ptaki: zielone, niebieskie, żółte, a czasami białe.

Na podstawie: B. Kosowska, Genetyka ogólna i weterynaryjna, Wrocław 2010.

16.1. (0–1)

Zapisz, stosując oznaczenia alleli podane w tekście, genotypy opisanej pary papużek falistych – niebieskiej i żółtej – oraz ich potomstwa (F1) o piórach zielonych.

Genotyp osobnika niebieskiego:
Genotyp osobnika żółtego:
Genotyp ich zielonego potomstwa (F1):

16.2. (0–1)

Zapisz, stosując oznaczenia alleli podane w tekście, wszystkie możliwe genotypy zielonych papużek falistych.

16.3. (0–2)

Określ prawdopodobieństwo (w %) pojawienia się białego osobnika wśród potomstwa białej papużki falistej i zielonego ptaka z pokolenia F1. Odpowiedź uzasadnij, zapisując odpowiednią krzyżówkę genetyczną (szachownicę Punnetta).

Prawdopodobieństwo: %

Informator CKE, Poziom rozszerzony (Formuła 2023)Zadanie 15. (1 pkt)

Inżynieria i badania genetyczne Podaj i uzasadnij/wyjaśnij
Zadanie anulowane przez CKE jako niezgodne z wymaganiami egzaminacyjnymi

Indukowane pluripotencjalne komórki macierzyste (komórki iPS) są pozyskiwane z komórek somatycznych, takich jak fibroblasty. W 2014 r. po raz pierwszy wszczepiono warstwę barwnikową siatkówki przygotowaną z komórek iPS w ramach leczenia zwyrodnienia plamki żółtej. Wcześniej nie stosowano przeszczepu siatkówki w leczeniu tego schorzenia.

Na podstawie: https://www.riken.jp/pr/news/2014/20140918_1/

Uzasadnij, że wszczepienie warstwy barwnikowej siatkówki otrzymanej z komórek iPS pacjenta, a nie – innego dawcy, jest korzystne dla tego pacjenta.

Informator CKE, Poziom rozszerzony (Formuła 2023)Zadanie 14. (8 pkt)

Układ immunologiczny Choroby człowieka Ekspresja informacji genetycznej Metody badawcze i doświadczenia Uzupełnij/narysuj wykres, schemat lub tabelę Zamknięte (np. testowe, prawda/fałsz) Podaj i uzasadnij/wyjaśnij

Współcześnie stosuje się dwie podstawowe metody wykrywania zakażeń HIV. Rutynowe badanie polega na wykrywaniu przeciwciał anty-HIV w surowicy pacjenta. W przypadku tej metody czułość badania, czyli prawdopodobieństwo otrzymania wyniku dodatniego u osoby chorej, tzn. wykrycia zakażenia, wynosi 100%, ale wynik dodatni otrzymuje się także dla 0,5% zdrowych osób – specyficzność wynosi 99,5%. Dlatego postawienie diagnozy zakażenia HIV wymaga potwierdzenia dodatkowym badaniem za pomocą metody PCR, wykrywającym gen odwrotnej transkryptazy wbudowany w genom gospodarza. Ta metoda jest teoretycznie bezbłędna pod warunkiem utrzymywania wysokich standardów pracy laboratoryjnej. Odpowiednie próby kontrolne służą sprawdzeniu, czy:

  • polimeraza DNA nie utraciła aktywności podczas przechowywania (kontrola pozytywna),
  • wszystkie odczynniki są wolne od wirusowego materiału genetycznego (kontrola negatywna).

Dla trzech pacjentów uzyskano dodatni wynik testu na obecność przeciwciał anty-HIV. Z tego powodu lekarz zlecił dodatkowe badanie z wykorzystaniem metody PCR, którego wyniki podsumowano w poniższej tabeli.

Próba
badawcza kontrolna pozytywna kontrolna negatywna
Pacjent 1. +
Pacjent 2. + + +
Pacjent 3. + +

Na podstawie: GenBank sekwencja nr KR861191.1; M. Fearon, The Laboratory Diagnosis of HIV Infections, „Can J Dis Med Microbiol” 16, 2005, s. 26–30;
D.S Boyle i inni, Rapid Detection of HIV-1 Proviral DNA for Early Infant Diagnosis Using Recombinase Polymerase Amplification, „mBio” 4, 2013, e00135–13;
S. Koblavi-Dème i inni, Sensitivity and Specificity of Human Immunodeficiency Virus Rapid Serologic Assays and Testing Algorithms in an Antenatal Clinic in Abidjan, Ivory Coast, „J Clin Microbiol” 39, 2001, s. 1808–1812.

14.1. (0–2)

Zaprojektuj doświadczenie PCR wykrywające DNA HIV wbudowane w genom gospodarza. Dla każdej z prób – badawczej, kontrolnej pozytywnej i kontrolnej negatywnej – wybierz wszystkie właściwe składniki mieszaniny reakcyjnej. Wpisz w tabelę znak „+”, jeśli składnik należy dodać do próby, albo znak „–”, jeśli ten składnik należy pominąć.

Próba
badawcza kontrolna pozytywna kontrolna negatywna
DNA genomowy wyizolowany od pacjenta
DNA genomowy wyizolowany z linii komórkowej zakażonej HIV
para specyficznych starterów
bufor zapewniający optymalne pH i stężenie jonów Mg2+
termostabilna polimeraza DNA
mieszanina deoksyrybonukleotydów

14.2. (0–1)

Wybierz spośród A–D i zaznacz prawidłowe sekwencje starterów polF1 i polR1, wykorzystywanych w teście diagnostycznym HIV, przyłączających się do zaznaczonych fragmentów poniższej sekwencji genu odwrotnej transkryptazy wirusa HIV, wbudowanej w genom gospodarza.

  1. polF1 5′ CCCTACAATCCCCAAAGTCAAGGAGTAGTAGAA 3′
    polR1 5′ CTCTGGAAAGGTGAAGGGGCAGTAGTAATACA 3′
  2. polF1 5′ TTCTACTACTCCTTGACTTTGGGGATTGTAGGG 3′
    polR1 5′ TGTATTACTACTGCCCCTTCACCTTTCCAGAG 3′
  3. polF1 5′ CCCTACAATCCCCAAAGTCAAGGAGTAGTAGAA 3′
    polR1 5′ TGTATTACTACTGCCCCTTCACCTTTCCAGAG 3′
  4. polF1 5′ TTCTACTACTCCTTGACTTTGGGGATTGTAGGG 3′
    polR1 5′ CTCTGGAAAGGTGAAGGGGCAGTAGTAATACA 3′

14.3. (0–2)

Podpunkt anulowany przez CKE

Przed zabiegiem chirurgicznym pacjentowi wykonano testy na nosicielstwo wirusa HIV wykrywające przeciwciała anty-HIV. Wynik wyszedł dodatni. Pacjent nie znajduje się w żadnej z grup ryzyka zakażenia HIV. Według oficjalnych danych częstość występowania zakażenia HIV w Polsce wynosi ok. 40 osób na 100 tys.

Oblicz prawdopodobieństwo, że pacjent jest zakażony HIV, z uwzględnieniem czułości i specyficzności testu na przeciwciała anty-HIV. Zapisz obliczenia w wyznaczonych miejscach 1.–3.

  1. Oczekiwana liczba osób zakażonych HIV, u których wynik testu na przeciwciała anty-HIV będzie dodatni, wśród 100 tys. losowo przebadanych osób:
  2. Oczekiwana liczba osób zdrowych (niezakażonych), u których wynik testu na przeciwciała anty-HIV będzie dodatni, wśród 100 tys. losowo przebadanych osób:
  3. Prawdopodobieństwo, że pacjent z dodatnim wynikiem testu na przeciwciała anty-HIV jest zakażony HIV:

14.4. (0–1)

Oceń, czy poniższe interpretacje przedstawionych wyników badań trojga pacjentów są prawidłowe. Zaznacz T (tak), jeśli interpretacja jest prawidłowa, albo N (nie) – jeśli jest nieprawidłowa.

1. U pacjenta 1. wynik testu na przeciwciała anty-HIV był fałszywie dodatni, o czym świadczy wykluczenie zakażenia na podstawie wyników PCR. T N
2. Wyniki testu PCR dla pacjenta 2. są niewiarygodne ze względu na dodatni wynik w próbie kontrolnej negatywnej – należy powtórzyć badanie. T N
3. Dodatkowe badanie techniką PCR potwierdziło podejrzenie, że pacjent 3. jest zakażony HIV. T N

14.5. (0–1)

Wyjaśnij, dlaczego testy wykrywające przeciwciała anty-HIV nie nadają się do diagnostyki zakażeń HIV u noworodków i niemowląt urodzonych przez matki zakażone HIV. W odpowiedzi uwzględnij spodziewany wynik testu oraz funkcjonowanie układu odpornościowego matki.

14.6. (0–1)

Oceń, czy poniższe osoby znajdują się w grupie zwiększonego ryzyka zakażenia HIV. Zaznacz T (tak), jeśli się w niej znajdują, albo N (nie) – jeśli w niej się nie znajdują.

1. Osoby przebywające w jednym pomieszczeniu z osobami zakażonymi HIV, np. w pracy lub szkole. T N
2. Osoby narażone na częste ukąszenia komarów i innych owadów odżywiających się krwią. T N
3. Sąsiedzi osób zakażonych HIV, mieszkający w tym samym domu wielorodzinnym. T N

Informator CKE, Poziom rozszerzony (Formuła 2023)Zadanie 13. (4 pkt)

Dziedziczenie Podaj i uzasadnij/wyjaśnij Podaj/wymień

Umaszczenie świń rasy duroc jest warunkowane przez dwie pary alleli genów autosomalnych (B i b oraz D i d) dziedziczonych niezależnie i współdziałających ze sobą. U osobników tej rasy występują trzy rodzaje umaszczenia: ciemnorudy, piaskowy i biały. Do wytworzenia barwnika ciemnorudego konieczny jest co najmniej jeden allel dominujący z każdej pary. Podwójne homozygoty recesywne są białe, natomiast umaszczenie piaskowe mają osobniki, w których genotypie występują dwa allele recesywne tylko jednego z genów warunkujących umaszczenie.

Na podstawie: B. Kosowska, Genetyka ogólna i weterynaryjna, Wrocław 2010, s. 25.

13.1. (0–1)

Zapisz, stosując podane w tekście oznaczenia alleli genów odpowiedzialnych za umaszczenie, genotypy pary świń rasy duroc – piaskowej samicy i piaskowego samca, których potomstwo zawsze będzie ciemnorude.

Genotyp samicy:
Genotyp samca:

13.2. (0–3)

Określ prawdopodobieństwo, że kolejny potomek ciemnorudej samicy i białego samca, których potomstwo stanowią prosięta ciemnorude, piaskowe oraz białe, będzie miał umaszczenie piaskowe. Odpowiedź uzasadnij, zapisując krzyżówkę genetyczną lub obliczenia z komentarzem przedstawiającym tok rozumowania.

Informator CKE, Poziom rozszerzony (Formuła 2023)Zadanie 12. (2 pkt)

Ekspresja informacji genetycznej Zamknięte (np. testowe, prawda/fałsz)

Uzupełnij poniższe zdania tak, aby powstał poprawny opis zjawiska alternatywnego składania eksonów. W każdym nawiasie podkreśl właściwe określenie.

W wyniku alternatywnego składania eksonów może powstać (tylko jeden rodzaj / wiele rodzajów) mRNA. Dzięki temu w organizmach eukariotycznych obserwuje się znacznie (mniej / więcej) różnych białek w porównaniu z liczbą genów w genomie. Ze względu na to, że ten proces nie zachodzi w organizmach prokariotycznych, gdy planuje się otrzymanie eukariotycznego białka w komórkach bakterii, należy przeprowadzić odwrotną (transkrypcję / translację) mRNA, która pozwala uzyskać gen pozbawiony (eksonów / intronów).

Biomedica 2022, Poziom rozszerzony (Formuła 2015)Zadanie 27. (5 pkt)

Dziedziczenie Podaj/wymień

U pewnej rośliny kwiaty niebieskie (P) dominują nad kwiatami białymi (p), zaś nasiona kolczyste (B) nad gładkimi (b). Ogrodnik Władek skrzyżował homozygotyczne rośliny– roślinę o kwiatach białych i nasionach kolczystych z rośliną niebieską i nasionach gładkich.

27.1. (0–1)

Zapisz genotypy rodziców z pierwszego kojarzenia oraz wypisz ich gamety.

27.2. (0–2)

Krzyżowanie wsteczne polega na skrzyżowaniu osobnika z pokolenia F1 z zad. 27.1 z podanym rodzicem.

Zapisz genotypy i fenotypy otrzymane w potomstwie krzyżówki wstecznej z rodzicem o kwiatach białych i nasionach kolczystych.

27.3. (0–2)

Wykonaj krzyżowanie testowe, które polega na skrzyżowaniu homozygoty recesywnej z heterozygotą z pokolenia F1.

 

 

 

To zadanie pochodzi ze zbioru matura 2022 wydawnictwa Biomedica
Kup pełny zbiór zadań

Biomedica 2022, Poziom rozszerzony (Formuła 2015)Zadanie 26. (3 pkt)

Skład organizmów Ekspresja informacji genetycznej Podaj i uzasadnij/wyjaśnij Podaj/wymień

Poniżej przedstawiono schemat budowy polirybosomu.

26.1. (0–1)

Podaj, z jakiego rodzaju RNA zbudowane są rybosomy.

26.2. (0–1)

Wyjaśnij, jakie znaczenie dla efektywności pracy komórki ma występowanie polirybosomów.

26.3. (0–1)

Podaj, jak nazywa się proces zachodzący na polirybosomie.

To zadanie pochodzi ze zbioru matura 2022 wydawnictwa Biomedica
Kup pełny zbiór zadań

Informator CKE, Poziom rozszerzony (Formuła 2023)Zadanie 2. (4 pkt)

Oddychanie komórkowe Genetyka - pozostałe Metody badawcze i doświadczenia Zamknięte (np. testowe, prawda/fałsz) Podaj i uzasadnij/wyjaśnij

Organizmy modelowe są używane m.in. do badania zależności między genami, szlakami sygnałowymi i metabolizmem. Homeostaza lipidów i glukozy jest w podobny sposób kontrolowana u bezkręgowców i ssaków – za pomocą ścieżki sygnałowej uruchamianej przez insulinę. W celu określenia, czy dieta wysokotłuszczowa wpływa na metabolizm węglowodanów, lipidów i białek, przeprowadzono badania z wykorzystaniem identycznych genetycznie samic szczepu w1118 wywilżny karłowatej (Drosophila melanogaster) podzielonych na dwie grupy:

grupa I – osobniki hodowane na pożywce standardowej, wykorzystywanej w laboratoriach do hodowli wywilżny i zapewniającej jej wszystkie niezbędne do normalnego rozwoju składniki odżywcze;
grupa II – osobniki hodowane na pożywce standardowej, do której dodano oleju kokosowego (pożywka o dużej zawartości tłuszczów nasyconych).

Po tygodniu oznaczono zawartość określonych metabolitów u osobników należących do każdej z grup.

Na poniższych wykresach przedstawiono zawartość względną kwasów tłuszczowych (A) oraz zawartość względną wybranych metabolitów (B) w ciele much karmionych pożywką o wysokiej zawartości tłuszczów nasyconych, w porównaniu z zawartością tych związków w 1 mg masy ciała much karmionych pożywką standardową.

Informacja do wykresu
■ pożywka standardowa
□ pożywka o wysokiej zawartości tłuszczów nasyconych

Słupki błędu oznaczają odchylenie standardowe obliczone na podstawie 15 pomiarów.

Na podstawie: E.T. Heinrichsen i inni, Metabolic and transcriptional response to a high-fat diet in Drosophila melanogaster, „Molecular Metabolism” 3, 2014, s. 42–54.

2.1. (0–1)

Oceń, czy poniższe interpretacje przedstawionych wyników badań są prawidłowe. Zaznacz T (tak), jeśli interpretacja wyników jest prawidłowa, albo N (nie) – jeśli jest nieprawidłowa.

1. W przypadku diety bogatej w tłuszcze nasycone pomiary zawartości kwasu mlekowego miały większą zmienność niż pomiary zawartości kwasu moczowego. T N
2. Wszystkie wyniki pomiarów względnej zawartości kwasu pirogronowego były mniejsze od czterech. T N
3. Najwyższy wynik pomiaru zawartości kwasu pirogronowego w próbie z pożywką standardową był mniejszy od najwyższego wyniku w próbie z pożywką o wysokiej zawartości tłuszczów nasyconych. T N

2.2 (0–1)

Wyjaśnij, dlaczego doświadczenie przeprowadzono na genetycznie identycznych osobnikach tej samej płci Drosophila melanogaster – należących do jednego szczepu w1118.

2.3. (0–1)

Określ, która grupa Drosophila melanogaster – I czy II – stanowiła w opisanym doświadczeniu próbę kontrolną. Odpowiedź uzasadnij, odwołując się do roli tej próby w interpretacji wyników doświadczenia.

2.4. (0–1)

Uzupełnij poniższe zdania tak, aby stanowiły poprawną interpretację uzyskanych wyników opisanego doświadczenia. W każdym nawiasie podkreśl właściwe określenie.

Zaobserwowany u osobników wywilżny karłowatej odżywiających się pokarmem bogatotłuszczowym (spadek / wzrost) poziomu kwasu mlekowego świadczy o (zmniejszeniu / zwiększeniu) intensywności przemian kwasu pirogronowego w cytozolu ich komórek. Zaobserwowane zaburzenia w metabolizmie kwasu pirogronowego mogą być efektem zwiększonej intensywności (redukcji / utleniania) kwasów tłuszczowych, jako że w wyniku tego procesu powstaje acetylokoenzym A, dostarczający grupy acetylowe do cyklu Krebsa.

Matura Maj 2021, Poziom rozszerzony (Formuła 2015)Zadanie 19. (5 pkt)

Układ krążenia Choroby człowieka Dziedziczenie Ekspresja informacji genetycznej Zamknięte (np. testowe, prawda/fałsz) Podaj i uzasadnij/wyjaśnij Podaj/wymień

W strukturze genu obok fragmentów kodujących (eksonów) mogą występować elementy niekodujące, takie jak promotor lub introny.

W poniższej tabeli przedstawiono informacje na temat sześciu wybranych genów człowieka, oznaczonych numerami 1.–6., kodujących określone białka.

Oznaczenie genu Kodowane białko Oznaczenie chromosomu Wielkość genu (kpz DNA) Wielkość mRNA (kz)
1. α-globina 16 0,8 0,5
2. albumina 4 25,0 2,1
3. receptor LDL 19 45,0 5,5
4. kinaza zależna od cyklin 4 54,0 1,7
5. hydroksylaza fenyloalaninowa 12 90,0 2,4
6. dystrofina X 2000,0 16,0

kpz – tysiąc par zasad
kz – tysiąc zasad

Na podstawie: red. J. Bal, Biologia molekularna w medycynie, Warszawa 2013;
https://ghr.nlm.nih.gov/gene;
https://www.ncbi.nlm.nih.gov.

19.1. (0–1)

Podaj nazwę procesu, którego produktem jest pre-mRNA, oraz określ lokalizację tego procesu w komórce człowieka.

Nazwa procesu:
Lokalizacja procesu:

19.2. (0–1)

Wyjaśnij, z czego wynikają różnice między wielkościami genów a wielkościami cząsteczek mRNA, które im odpowiadają.

19.3. (0–1)

Podaj nazwę choroby, u podłoża której leży mutacja genu kodującego hydroksylazę fenyloalaninową, prowadząca do utraty funkcji tego enzymu niezbędnego w metabolizmie fenyloalaniny.

19.4. (0–1)

Spośród wymienionych w tabeli wybierz i zapisz oznaczenia pary genów, które mogą dziedziczyć się niezgodnie z II prawem Mendla. Odpowiedź uzasadnij, odwołując się do treści tego prawa oraz do lokalizacji wybranych genów w genomie.

19.5. (0–1)

Uzupełnij poniższe zdania tak, aby powstał poprawny opis dotyczący albumin. Podkreśl w każdym nawiasie właściwe określenie.

Albuminy to białka (rozpuszczalne / nierozpuszczalne) w wodzie, występujące głównie (w cytoplazmie erytrocytów / w osoczu krwi). Główną funkcją tych białek jest (transport tlenu / regulacja ciśnienia osmotycznego krwi).

Matura Maj 2021, Poziom rozszerzony (Formuła 2015)Zadanie 17. (3 pkt)

Choroby człowieka Dziedziczenie Zamknięte (np. testowe, prawda/fałsz) Podaj i uzasadnij/wyjaśnij Podaj/wymień

Przyczyną wrodzonej nietolerancji fruktozy są mutacje w genie ALDOB, kodującym enzym aldolazę B i zlokalizowanym na chromosomie 9. Jeżeli uszkodzona jest tylko jedna kopia genu, oznacza to nosicielstwo tej choroby, co w większości przypadków nie wywołuje żadnych objawów. Częstość występowania wrodzonej nietolerancji fruktozy u człowieka wynosi 1/40 000. Objawy choroby ujawniają się zwykle w okresie niemowlęcym po zakończeniu karmienia dziecka wyłącznie mlekiem matki, kiedy do diety dziecka wprowadzane są pierwsze owoce i warzywa. Wrodzona nietolerancja fruktozy prowadzi, po spożyciu tego cukru, do gromadzenia się jego metabolitów w komórkach wątroby: brak aldolazy B powoduje nagromadzenie fruktozo-1-fosforanu, co z kolei prowadzi do upośledzenia glukoneogenezy oraz ograniczenia syntezy ATP. U osób chorych należy wykluczyć z diety owoce, niektóre warzywa, miód oraz cukier spożywczy (sacharozę).

Na podstawie: https://biotechnologia.pl/;
L. Szablewski, A. Skopińska, Zaburzenia metabolizmu węglowodanów powodowane mutacjami i rola diety jako terapii. Część II. Fruktozemia, „Medycyna Rodzinna” 4, 2005.

17.1. (0–1)

Dokończ zdanie. Zaznacz właściwą odpowiedź spośród podanych.

Wrodzona nietolerancja fruktozy jest dziedziczona w sposób

  1. autosomalny recesywny.
  2. autosomalny dominujący.
  3. sprzężony z płcią recesywny.
  4. sprzężony z płcią dominujący.

17.2. (0–1)

Oblicz częstość występowania nosicieli wrodzonej nietolerancji fruktozy w populacji pozostającej w stanie równowagi genetycznej, w której częstość występowania wrodzonej nietolerancji fruktozy wynosi 1/40 000.

Obliczenia:

 

 

Częstość występowania nosicieli wrodzonej nietolerancji fruktozy wynosi:

17.3. (0–1)

Uzasadnij, że osoba cierpiąca na wrodzoną nietolerancję fruktozy powinna wyeliminować z diety sacharozę.

Matura Maj 2021, Poziom rozszerzony (Formuła 2015)Zadanie 1. (3 pkt)

Skład organizmów Ekspresja informacji genetycznej Podaj i uzasadnij/wyjaśnij Podaj/wymień

Prolaktyna, wydzielana przez gruczołową część przysadki mózgowej, jest jednołańcuchowym polipeptydem złożonym ze 199 aminokwasów, powstającym w wyniku odcięcia peptydu sygnałowego liczącego 28 aminokwasów. Na poniższym schemacie przedstawiono strukturę przestrzenną cząsteczki dojrzałej ludzkiej prolaktyny.

Na podstawie: S.J. Konturek, Fizjologia człowieka, Wrocław 2013; Protein Data Bank, https://www.rcsb.org/structure/1RW5.

1.1. (0–1)

Określ dominującą strukturę II-rzędową w cząsteczce dojrzałej ludzkiej prolaktyny.

1.2. (0–1)

Na podstawie przedstawionych informacji określ najwyższą rzędowość struktury białka – prolaktyny. Odpowiedź uzasadnij, odwołując się do cech budowy tego białka.

1.3. (0–1)

Podaj całkowitą liczbę kodonów w mRNA stanowiącym matrycę podczas syntezy prolaktyny.

Matura Marzec 2021, Poziom rozszerzony (Formuła 2015)Zadanie 19. (3 pkt)

Dziedziczenie Podaj i uzasadnij/wyjaśnij

Wywilżna karłowata (Drosophila melanogaster) ma 4 pary chromosomów, z których jedna para to chromosomy płci: X i Y. U tego gatunku płeć jest determinowana przez stosunek liczby chromosomów X do autosomów. Samice mają zazwyczaj dwa chromosomy X, a normalne płodne samce jeden chromosom X i jeden chromosom Y. Geny warunkujące kolor oczu (czerwony lub biały) oraz kolor ciała (jasnobrunatny lub czarny) dziedziczą się niezależnie od siebie. Allel warunkujący barwę czerwoną oczu (A) jest dominujący, podobnie jak allel warunkujący jasnobrunatną barwę ciała (B).

Aby sprawdzić, która z podanych cech dziedziczy się autosomalnie, a która jest sprzężona z płcią, skrzyżowano czarnego samca (XY) o oczach czerwonych z jasnobrunatną samicą (XX) o oczach białych. Stwierdzono, że wszystkie osobniki z pierwszego pokolenia miały jasnobrunatną barwę ciała, ale wszystkie samce miały oczy białe, natomiast wszystkie samice miały oczy czerwone.

19.1. (0–1)

Podaj genotypy samca i samicy oraz ich potomstwa w przeprowadzonym doświadczeniu. Zastosuj podane w tekście oznaczenia alleli.

Genotyp samca:
Genotyp samicy:
Genotypy potomstwa (F1):

19.2. (0–2)

Podaj genotypy czarnego samca i jasnobrunatnej samicy, w których potomstwie mogłyby się pojawić się osobniki o czarnej barwie ciała. Odpowiedź uzasadnij.

Genotyp samca:
Genotyp samicy:

Uzasadnienie:

Matura Marzec 2021, Poziom rozszerzony (Formuła 2015)Zadanie 18. (3 pkt)

Genetyka - pozostałe Uzupełnij/narysuj wykres, schemat lub tabelę Zamknięte (np. testowe, prawda/fałsz) Podaj i uzasadnij/wyjaśnij

Mutacja genowa może być mutacją punktową, ale może też polegać na podstawieniu, wstawieniu bądź wycięciu większego odcinka DNA.

Na schemacie strzałkami oznaczono podstawienia nukleotydowe w łańcuchu DNA.

18.1. (0–1)

Uzupełnij schemat – wpisz w wyznaczone kropkami miejsca symbole trzech pozostałych nukleotydów w taki sposób, aby schemat prawidłowo ilustrował transwersje – podstawienia nukleotydu purynowego na pirymidynowy i odwrotnie.

18.2. (0–1)

Określ, która z mutacji – insercja pojedynczego nukleotydu czy podstawienie – może spowodować zmianę ramki odczytu w sekwencji kodującej białko. Odpowiedź uzasadnij.

18.3. (0–1)

Oceń, czy poniższe informacje dotyczące mutacji są prawdziwe. Zaznacz P, jeśli informacja jest prawdziwa, albo F – jeśli jest fałszywa.

1. Konsekwencją mutacji genowej w pierwszej pozycji kodonu jest zwykle zmiana struktury pierwszorzędowej białka kodowanego przez ten gen. P F
2. U roślin okrytozalążkowych rozmnażających się generatywnie mutacje somatyczne mogą być przekazywane potomstwu. P F
3. Aneuploidie polegają na utracie lub występowaniu dodatkowych pojedynczych chromosomów. P F

Matura Marzec 2021, Poziom rozszerzony (Formuła 2015)Zadanie 2. (5 pkt)

Budowa i funkcje komórki Ekspresja informacji genetycznej Podaj/wymień Zamknięte (np. testowe, prawda/fałsz)

Na poniższym rysunku przedstawiono jeden z etapów translacji. Literami: E, P i A zaznaczono trzy miejsca funkcyjne rybosomu.

https://pl.khanacademy.org

2.1. (0–1)

Podaj nazwę aminokwasu oznaczonego na rysunku literą X.

Nazwa aminokwasu:

2.2. (0–1)

Oceń czy poniższe stwierdzenia dotyczące rybosomów w komórkach eukariotycznych są prawdziwe. Zaznacz P, jeśli stwierdzenie jest prawdziwe, albo F – jeśli jest fałszywe.

1. Funkcjonalny rybosom w komórce eukariotycznej składa się z dwóch podjednostek: małej i dużej, które są zbudowane z białek i rRNA. P F
2. Wszystkie rybosomy w komórce eukariotycznej są jednakowej wielkości i pełnią te same funkcje. P F
3. W komórkach eukariotycznych białka produkowane na eksport powstają na rybosomach związanych z siateczką śródplazmatyczną. P F

2.3. (0–2)

Do funkcji rybosomu 1.–4., pełnionych podczas translacji przez poszczególne miejsca funkcyjne rybosomu, przyporządkuj ze schematu ich odpowiednie oznaczenia wybrane spośród: E, P lub A.

  1. Przyłączanie inicjatorowego tRNA rozpoczynającego translację:
  2. Wiązanie aminoacylo-tRNA:
  3. Wiązanie peptydylo-tRNA:
  4. Uwalnianie z rybosomu wolnego tRNA:

2.4. (0–1)

Uzupełnij poniższe zdania tak, aby zawierały one prawdziwe informacje dotyczące translacji. Podkreśl w każdym nawiasie właściwe określenie.

Do połączenia podjednostek rybosomu dochodzi tylko w przypadku przyłączenia do (małej / dużej) podjednostki odpowiedniego rodzaju kwasu nukleinowego – (tRNA / końca 3ʹ mRNA / końca 5ʹ mRNA). Zachodzi wtedy proces (inicjacji / elongacji / terminacji) translacji.

Strony