Genetyka

Oto lista zadań maturalnych z danego działu biologii. Aby skorzystać z dodatkowych opcji lub wybrać zadania z pozostałych działów kliknij poniżej.

Przejdź do wyszukiwarki zadań

 

Arkusz pokazowy CKE Marzec 2022, Poziom rozszerzony (Formuła 2023)Zadanie 18. (1 pkt)

Ekspresja informacji genetycznej Podaj i uzasadnij/wyjaśnij

Białko TBP jest czynnikiem transkrypcyjnym niezbędnym w procesie inicjowania transkrypcji genów eukariotycznych. Białko to wiąże się z promotorem genu, w którym zwykle występuje więcej par AT niż par GC. Białko TBP wygina dwuniciową cząsteczkę DNA o ok. 80 stopni, doprowadzając do rozdzielenia nici DNA. Umożliwia to przyłączenie do DNA polimerazy RNA i rozpoczęcie transkrypcji.

Wykaż, że większy udział par AT niż par GC w promotorze genu ułatwia rozdzielenie dwuniciowego DNA na pojedyncze nici.

Arkusz pokazowy CKE Marzec 2022, Poziom rozszerzony (Formuła 2023)Zadanie 17. (3 pkt)

Dziedziczenie Podaj i uzasadnij/wyjaśnij

Samce ptaków są homogametyczne (ZZ), natomiast samice – heterogametyczne (ZW). U kury domowej na chromosomie Z występuje gen, który odpowiada za kolor upierzenia: dominujący allel B tego genu warunkuje upierzenie srebrzyste, natomiast recesywny allel b – upierzenie złociste.

Skrzyżowano srebrzystą kurę ze srebrzystym kogutem, a wśród ich potomstwa były kurczaki srebrzyste oraz złociste.

Na podstawie: B. Kosowska, Genetyka ogólna i weterynaryjna, Wrocław 2010.

Podaj oczekiwany stosunek fenotypowy kurczaków srebrzystych i złocistych w potomstwie tej pary ptaków oraz określ prawdopodobieństwo, że złocisty kurczak będzie samicą. Odpowiedzi uzasadnij, zapisując krzyżówkę genetyczną.

Krzyżówka genetyczna:

Oczekiwany stosunek fenotypowy:

Prawdopodobieństwo:

Arkusz pokazowy CKE Marzec 2022, Poziom rozszerzony (Formuła 2023)Zadanie 16. (2 pkt)

Mutacje Zamknięte (np. testowe, prawda/fałsz) Podaj i uzasadnij/wyjaśnij

Zespół łamliwego chromosomu X jest najczęstszą przyczyną genetycznie uwarunkowanej niepełnosprawności intelektualnej. Choroba dziedziczy się jako cecha dominująca sprzężona z płcią. Jest ona spowodowana powieleniem sekwencji CGG w odcinku genu FMR1, położonym między promotorem transkrypcji a kodonem start. Ten odcinek w wyniku transkrypcji stanowi część mRNA, ale nie ulega translacji. U osób zdrowych liczba powtórzeń CGG w tym odcinku wynosi 6–54, jeśli powtórzeń jest 55–200 (tzw. premutacja), objawy nie występują, natomiast osoby chore mają ponad 200 takich powtórzeń (pełna mutacja).

W locus genu FMR1, blisko końca długiego ramienia chromosomu X, w miejscu, w którym występują bardzo liczne powtórzenia CGG, pojawia się charakterystyczne przewężenie, tzw. miejsce łamliwe. Gen FMR1 warunkuje wytwarzanie białka FMRP, które jest jednym z najważniejszych regulatorów translacji w komórkach nerwowych i odpowiada za ich rozwój oraz prawidłowe funkcjonowanie.

Na podstawie: G. Drewa, T. Ferenc, Genetyka medyczna, Wrocław 2015; E.W. Khandjian i inni, The Fragile X Syndrome, eLS, 2017; rarediseases.org/gard-rare-disease/fragile-x-syndrome/

16.1. (0–1)

Zaznacz schemat pary chromosomów X tworzących biwalent w profazie I mejozy u kobiety, która jest heterozygotą z pełną mutacją.

16.2. (0–1)

Rozstrzygnij, czy w wyniku opisanej mutacji może powstać białko FMRP o dłuższym łańcuchu polipeptydowym niż prawidłowe białko FMRP. Odpowiedź uzasadnij.

Arkusz pokazowy CKE Marzec 2022, Poziom rozszerzony (Formuła 2023)Zadanie 15. (3 pkt)

Układ nerwowy i narządy zmysłów Ewolucjonizm i historia życia na ziemi Dziedziczenie Podaj/wymień Podaj i uzasadnij/wyjaśnij

Achromatopsja to całkowita ślepota na barwy, która jest warunkowana przez recesywny allel autosomalny (a). Osoba dotknięta tą chorobą widzi świat jedynie w czerni, bieli i odcieniach szarości ze względu na brak jednego z typów komórek światłoczułych w gałce ocznej. Jest to bardzo rzadkie zaburzenie – na świecie występuje z częstością 0,005%, ale aż 8% mieszkańców Pingelap – małej, izolowanej wyspy na Oceanie Spokojnym – wykazuje objawy achromatopsji.

Przyczyny tego stanu rzeczy upatruje się w niszczycielskim tajfunie, który uderzył w wyspę Pingelap w 1775 r. i spowodował śmierć 90% jej mieszkańców. Kataklizm przeżyło tylko 20 osób i to one z czasem odnowiły populację Pingelap. Wszystko wskazuje na to, że jeden z ocalałych mężczyzn był nosicielem achromatopsji. Ponadto w tak małej i izolowanej populacji nie dało się uniknąć kojarzenia krewniaczego.

Na podstawie: S.S. Mader, M. Windelspecht, Biology. 12th Edition, Nowy Jork 2016.

15.1. (0–1)

Podaj nazwę typu komórek światłoczułych, których brakuje u osób chorych na achromatopsję.

15.2. (0–1)

Wyjaśnij, dlaczego śmierć 90% mieszkańców wyspy Pingelap w 1775 r. doprowadziła do zwiększonej współcześnie częstości występowania achromatopsji w tej populacji. W odpowiedzi uwzględnij genetyczne podłoże zjawiska.

15.3. (0–1)

Wykaż, że już w drugim pokoleniu po przejściu tajfunu w populacji mogły się pojawić osoby z objawami achromatopsji. Uzupełnij szachownice Punetta – w odpowiednie miejsca wpisz genotypy gamet oraz genotypy potomstwa.

Arkusz pokazowy CKE Marzec 2022, Poziom rozszerzony (Formuła 2023)Zadanie 14. (5 pkt)

Prokarionty Ekspresja informacji genetycznej Inżynieria i badania genetyczne Podaj/wymień Podaj i uzasadnij/wyjaśnij Zamknięte (np. testowe, prawda/fałsz)

Plazmidy bakteryjne zazwyczaj nie zawierają genów metabolizmu podstawowego, ale mogą np. zapewniać oporność na antybiotyki. Plazmidy lub ich fragmenty mogą być przekazywane między komórkami bakteryjnymi w czasie podziału komórki lub w procesach horyzontalnego transferu genów: koniugacji, transdukcji i transformacji. Plazmidy mogą dawać bakteriom przewagę selekcyjną. Znalazły one także zastosowanie w biotechnologii.

Bakterie mają wiele mechanizmów zapobiegających utracie plazmidów przez dzielące się komórki, np. system ccd plazmidu F bakterii Escherichia coli. Ten system tworzą dwa geny: gen ccdA kodujący antidotum oraz gen ccdB kodujący truciznę. Obydwa geny podlegają transkrypcji ze wspólnego promotora. Podczas normalnego funkcjonowania komórki bakteryjnej trucizna pozostaje związana przez antidotum i nie wywiera toksycznego wpływu na gyrazę – enzym usuwający napięcia w nici DNA powstające podczas replikacji materiału genetycznego. Jeśli komórka utraci po podziale plazmid z genami systemu ccd, obecne w jej cytoplazmie nietrwałe antidotum zostaje zdegradowane, a stosunkowo trwała toksyna wiąże się z gyrazą, co prowadzi do śmierci komórki w wyniku uszkodzenia DNA.

Aktywność promotora genów ccdA i ccdB jest hamowana przez produkty tych genów.

Na poniższych schematach przedstawiono funkcjonowanie systemu ccd:

  • schemat A – ekspresja genów ccdA oraz ccdB
  • schemat B – trucizna unieszkodliwiana przez antidotum
  • schemat C – degradacja antidotum i wiązanie trucizny z gyrazą.
Na podstawie: U. Zieleniewicz, P. Cegłowski, Mechanizmy stabilnego dziedziczenia plazmidów, „Kosmos” 51(3), 2002.

14.1. (0–1)

Podaj nazwę sposobu horyzontalnego transferu genów zachodzącego z udziałem wirusów.

14.2. (0–1)

Wykaż, że horyzontalny transfer genów zwiększa tempo ewolucji adaptacyjnej bakterii.

14.3. (0–1)

Uzupełnij poniższe zdania tak, aby opis dotyczący funkcjonowania genów systemu ccd był prawdziwy. W każdym nawiasie podkreśl właściwe określenie.

Ekspresja genów systemu ccd regulowana jest na zasadzie (negatywnego / pozytywnego) sprzężenia zwrotnego. Obecność w komórce produktów genów systemu ccd sprawia, że (zachodzi / nie zachodzi) transkrypcja tych genów.

14.4. (0–1)

Uzasadnij, że zahamowanie ekspresji genów systemu ccd doprowadzi do śmierci komórki zawierającej plazmid z tym systemem. W odpowiedzi uwzględnij produkty genów systemu ccd i ich trwałość w komórce.

14.5. (0–1)

Określ, w jakim celu do wektorów plazmidowych wykorzystywanych w inżynierii genetycznej wprowadza się gen oporności na antybiotyk.

Matura Czerwiec 2022, Poziom rozszerzony (Formuła 2015)Zadanie 16. (2 pkt)

Dziedziczenie Podaj i uzasadnij/wyjaśnij

U królików podstawowe typy umaszczenia uwarunkowane są szeregiem alleli wielokrotnych (B, bh, b) o pełnej dominacji. Umaszczenie dzikie warunkuje allel B, himalajskie – allel bh, który jest recesywny względem B i dominujący względem b, natomiast umaszczenie albinotyczne warunkuje allel b w układzie homozygotycznym. Cecha dziedziczona jest autosomalnie.

Samica o umaszczeniu himalajskim i samiec o umaszczeniu dzikim mają albinotyczne potomstwo.

Na podstawie: K.M. Charon, M. Świtoński, Genetyka i genomika zwierząt, Warszawa 2012.

Określ prawdopodobieństwo, że kolejny potomek tej pary królików także będzie albinosem. Odpowiedź uzasadnij – zapisz krzyżówkę genetyczną (szachownicę Punnetta), posługując się oznaczeniami alleli podanymi w tekście.

Prawdopodobieństwo wynosi: %

Matura Czerwiec 2022, Poziom rozszerzony (Formuła 2015)Zadanie 15. (4 pkt)

Ekspresja informacji genetycznej Mutacje Zamknięte (np. testowe, prawda/fałsz) Podaj i uzasadnij/wyjaśnij Podaj/wymień

U owiec gen BMP15 zlokalizowany jest na chromosomie X i zawiera dwa eksony oddzielone od siebie intronem o długości ok. 5400 pz (par zasad), a pełna długość sekwencji kodującej (z uwzględnieniem kodonu stop) to 1182 pz. Propeptyd białka BMP15 (niedojrzałe białko) zawiera peptyd sygnałowy, który następnie ulega usunięciu. Dojrzała forma białka BMP15 składa się ze 125 aminokwasów.

W poniższej tabeli opisano dwa zmutowane allele genu BMP15. Allele Fec XB oraz Fec XL są odpowiedzialne za zwiększenie częstości owulacji u owiec.

Allel genu BMP15 Podstawienie nukleotydu w kodonie Pozycja podstawionego aminokwasu
w propeptydzie w dojrzałym białku
Fec XB AGC → AUC 367 99
Fec XL UGU → UAU 321 53
Na podstawie: G. Smołucha, A. Piestrzyńska-Kajtoch, B. Rejduch, Genetyczny aspekt wysokiej plenności u owiec. Cz. I, „Wiadomości Zootechniczne” 1, 2012.

15.1. (0–1)

Na podstawie przedstawionych informacji wykaż, że w procesie ekspresji genu BMP15 dochodzi do potranskrypcyjnej obróbki RNA.

15.2. (0–1)

Dokończ zdanie. Zaznacz właściwą odpowiedź spośród podanych.

Propeptyd białka BMP15 (niedojrzałe białko) zawiera

  1. 125 aminokwasów.
  2. 268 aminokwasów.
  3. 393 aminokwasy.
  4. 1179 aminokwasów.

15.3. (0–1)

Uzupełnij poniższe zdania tak, aby zawierały informacje prawdziwe. W każdym nawiasie podkreśl właściwe określenie.

Mutacje Fec XB i Fec XL są mutacjami (genowymi / chromosomowymi). Są to (mutacje punktowe / delecje), które (skutkują / nie skutkują) przesunięciem ramki odczytu.

15.4. (0–1)

Zapisz nazwy aminokwasów, którymi różnią się białko kodowane przez prawidłowy allel genu BMP15 i białko kodowane przez zmutowany allel Fec XL.

Nazwa aminokwasu w białku kodowanym przez

  1. prawidłowy allel:
  2. zmutowany allel Fec XL:

Matura Maj 2022, Poziom rozszerzony (Formuła 2015)Zadanie 18. (5 pkt)

Choroby człowieka Dziedziczenie Ekspresja informacji genetycznej Mutacje Podaj i uzasadnij/wyjaśnij Podaj/wymień

Autosomalny gen HTT koduje białko – huntingtynę. Niezmutowany allel h koduje huntingtynę o prawidłowej strukturze, podczas gdy zmutowany allel H skutkuje powstaniem niewłaściwej formy huntingtyny, warunkującej chorobę Huntingtona. Allel H ma charakter dominujący, a obecność nawet tylko jednej jego kopii w genomie jest przyczyną poważnych zaburzeń fizycznych i umysłowych, które powodują śmierć w przeciągu 15–20 lat od wystąpienia objawów.

W genie HTT stosunkowo często pojawia się mutacja polegająca na występowaniu dodatkowych kodonów CAG. Wywołujący chorobę allel H ma więcej niż 35 takich trójek nukleotydów. W większości przypadków objawy choroby rozwijają się między czwartą a szóstą dekadą życia.

Na podstawie: journals.viamedica.pl; www.huntington.pl

18.1. (0–1)

Podaj nazwę rodzaju mutacji genowej występującej w allelu H, polegającej na obecności dodatkowych kodonów CAG.

18.2. (0–1)

Opisz, na czym polega zmiana w I-rzędowej strukturze białka huntingtyny będąca skutkiem obecności dodatkowych kodonów CAG.

18.3. (0–2)

Określ prawdopodobieństwo wystąpienia choroby Huntingtona u dziecka heterozygotycznej matki pod względem genu HTT oraz ojca będącego homozygotą recesywną pod względem tego genu. Odpowiedź uzasadnij, zapisując genotypy rodziców oraz krzyżówkę genetyczną.

Genotyp matki:    Genotyp ojca:

Krzyżówka:

Prawdopodobieństwo wystąpienia choroby Huntingtona:

18.4. (0–1)

Wyjaśnij, dlaczego w populacji ludzkiej utrzymuje się allel H warunkujący chorobę Huntingtona, mimo że jest on dominujący, a choroba – śmiertelna.

Matura Maj 2022, Poziom rozszerzony (Formuła 2015)Zadanie 17. (4 pkt)

Metody badawcze i doświadczenia Inżynieria i badania genetyczne Sformułuj wnioski, hipotezę lub zaplanuj doświadczenie Zamknięte (np. testowe, prawda/fałsz)

Populacje biegusów alaskańskich w północnej części zasięgu geograficznego gatunku mają nietypowy stosunek liczebności samców i samic wynoszący 3:1, zamiast typowego – 1:1. Postawiono następującą hipotezę:

„Mały udział samic w populacjach biegusów jest spowodowany tym, że częściej padają one ofiarą sokołów wędrownych”.

W celu weryfikacji tej hipotezy zebrano pióra po biegusach upolowanych przez sokoły, a następnie wyizolowano z nich DNA i przeprowadzono PCR w celu amplifikacji fragmentów genów CHD, zlokalizowanych na chromosomach płci Z i W (odpowiednio: CHD-Z i CHD-W). Samice biegusów są heterogametyczne (ZW), a samce – homogametyczne (ZZ).

Rejony niekodujące w genach CHD-Z i CHD-W mają różną długość, co powoduje, że produkty amplifikacji rejonów niekodujących genów CHD-Z i CHD-W także różnią się długością. Elektroforetyczne rozdzielenie produktów PCR pozwoliło określić płeć ptaków, z których pochodziły zebrane pióra.

Wyniki badań przedstawiono na poniższym wykresie.

Na podstawie: S. Nebel i in., Molecular sexing of prey remains […] in a wintering population of western sandpipers, „Proceedings of the Royal Society B” 271, 2004.

17.1. (0–1)

Rozstrzygnij, czy postawiona hipoteza została przyjęta, czy – odrzucona. Odpowiedź uzasadnij, odwołując się do wyników badań przedstawionych na wykresie.

17.2. (0–1)

Który obraz żelu agarozowego odpowiada prawidłowemu wynikowi elektroforetycznego rozdzielenia powielonych fragmentów genów CHD-Z i CHD-W u samca (♂) i samicy (♀)? Zaznacz właściwą odpowiedź spośród podanych.

17.3. (0–2)

Oceń, czy poniższe stwierdzenia dotyczące techniki PCR są prawdziwe. Zaznacz P, jeśli stwierdzenie jest prawdziwe, albo F – jeśli jest fałszywe.

1. Do powielenia fragmentów genów techniką PCR należy użyć m.in. termostabilnej polimerazy DNA oraz czterech różnych deoksyrybonukleotydów. P F
2. Technika PCR umożliwia powielenie wybranych fragmentów genomowego DNA dzięki użyciu specyficznych starterów. P F
3. Rozdzielenie podwójnej helisy DNA podczas stosowania techniki PCR zachodzi dzięki ligazom DNA. P F

Matura Maj 2022, Poziom rozszerzony (Formuła 2015)Zadanie 6. (6 pkt)

Wirusy, wiroidy, priony Prokarionty Choroby człowieka Mutacje Zamknięte (np. testowe, prawda/fałsz) Podaj i uzasadnij/wyjaśnij Podaj/wymień

Jeden z antybiotyków – streptomycyna – łączy się bezpośrednio z małą podjednostką rybosomu. Zaburza to syntezę białek bakteryjnych. Jednak nie wszystkie bakterie są wrażliwe na streptomycynę. U bakterii Mycobacterium tuberculosis oporność na streptomycynę warunkuje mutacja w genie kodującym podjednostkę 16S rRNA. W celu ustalenia właściwej dawki antybiotyku stosowanego w leczeniu chorób bakteryjnych określa się wartości:

  • MIC (ang. minimum inhibitory concentration) – minimalne stężenie antybiotyku, które całkowicie hamuje wzrost szczepu bakterii w pożywce płynnej
  • MBC (ang. minimum bactericidal concentration) – najmniejsze stężenie w pełni bakteriobójcze dla danego szczepu.

W celu ustalenia wartości MIC i MBC przygotowano osiem probówek z pożywką zawierającą taką samą, niewielką liczbę komórek pewnego szczepu bakterii. Po dodaniu do siedmiu probówek różnych ilości streptomycyny wszystkie osiem umieszczono w inkubatorze. Materiał z probówek, w których nie wykryto wzrostu bakterii, przeniesiono na pożywkę stałą bez streptomycyny. Poniższy schemat ilustruje wyniki tego doświadczenia.

Na podstawie: J. Baj, Mikrobiologia, Warszawa 2018; W. Irving i in., Krótkie wykłady. Mikrobiologia medyczna, Warszawa 2008; B. Springer i in., Mechanisms of Streptomycin Resistance: Selection of Mutations in the 16S rRNA Gene Conferring Resistance, „Antimicrob Agents Chemother” 45, 2001.

6.1. (0–1)

Na podstawie przedstawionych wyników doświadczenia odczytaj wartości MIC oraz MBC i wpisz je w wyznaczone poniżej miejsca.

wartość MIC: mg/l
wartość MBC: mg/l

6.2. (0–1)

Spośród podanych nazw chorób wybierz i zaznacz nazwy chorób bakteryjnych.

  1. AIDS
  2. borelioza
  3. WZW typu C
  4. gruźlica
  5. tężec

6.3. (0–1)

Wyjaśnij, dlaczego mutacja w jednym z genów kodujących rRNA bakterii M. tuberculosis może powodować nabycie przez szczep tych bakterii oporności na streptomycynę.

6.4. (0–1)

Dokończ zdanie. Zaznacz odpowiedź A, B albo C oraz jej uzasadnienie 1., 2. albo 3.

Rozprzestrzenianie się antybiotykooporności bezpośrednio między komórkami bakterii jest możliwe na drodze

A. transformacji, ponieważ 1. geny antybiotykooporności w wyniku cyklu lizogenicznego bakteriofagów mogą być wbudowane do genomu bakterii.
B. transdukcji, 2. geny antybiotykooporności mogą znajdować się w plazmidach, które są przekazywane innym komórkom bakteryjnym.
C. koniugacji, 3. wśród pobranych egzogennych fragmentów DNA może znaleźć się taki, który zawiera geny antybiotykooporności.

6.5. (0–2)

Wykaż, że wirusy nie są wrażliwe na streptomycynę. W odpowiedzi uwzględnij różnicę w budowie wirusów i bakterii oraz mechanizm działania streptomycyny.

Matura Maj 2022, Poziom rozszerzony (Formuła 2015)Zadanie 5. (3 pkt)

Budowa i funkcje komórki Dziedziczenie Zamknięte (np. testowe, prawda/fałsz) Podaj i uzasadnij/wyjaśnij

Mitogeny to cząsteczki sygnałowe, które wiążą się z receptorami na powierzchni komórki. Związanie mitogenu z odpowiednim receptorem błonowym uruchamia szlaki sygnalizacyjne w komórce, umożliwiające przejście komórki z fazy G1 cyklu komórkowego do fazy S. Jednym z czynników hamujących to przejście jest aktywna forma białka Rb, które blokuje transkrypcję genów kodujących białka niezbędne do podziału komórki.

Mutacja w genie RB1 zlokalizowanym na chromosomie 13, kodującym białko Rb, jest najczęstszą przyczyną retinoblastomy (siatkówczaka) – złośliwego nowotworu siatkówki występującego u dzieci z częstością 1/20 000 żywych urodzeń. Do rozwoju choroby dochodzi, gdy w komórce siatkówki zostanie całkowicie zahamowana produkcja białka Rb na skutek uszkodzenia lub usunięcia obu kopii genu RB1.

Choroba może mieć podłoże dziedziczne. W przypadku odziedziczenia jednego uszkodzonego allelu genu RB1 od rodzica drugi zwykle ulega mutacji spontanicznej w komórkach siatkówki podczas rozwoju osobniczego. Dzieci, które odziedziczyły uszkodzony allel genu RB1, mają wrodzoną skłonność do rozwoju siatkówczaka – ryzyko zachorowania wynosi aż 90%.

Na podstawie: B. Alberts i in., Podstawy biologii komórki, Warszawa 2017.

5.1. (0–1)

W której fazie cyklu komórkowego zachodzi replikacja DNA? Zaznacz właściwą odpowiedź spośród podanych.

  1. faza G1
  2. faza S
  3. faza G2
  4. faza M

5.2. (0–1)

Określ wpływ aktywnego białka Rb na częstość podziałów komórkowych.

5.3. (0–1)

Spośród pary rodziców, którzy zgłosili się do poradni genetycznej, przyszły ojciec nie ma mutacji w genie RB1, ale przyszła matka odziedziczyła uszkodzony allel RB1 po swoim ojcu.

Ile wynosi prawdopodobieństwo, że u dziecka tej pary rodziców rozwinie się siatkówczak? Zaznacz właściwą odpowiedź spośród podanych.

  1. 0%
  2. 25%
  3. 45%
  4. 75%
  5. 90%

Matura Lipiec 2020, Poziom rozszerzony (Formuła 2015)Zadanie 19. (5 pkt)

Dziedziczenie Choroby człowieka Genetyka - pozostałe Ewolucjonizm i historia życia na ziemi Podaj i uzasadnij/wyjaśnij Zamknięte (np. testowe, prawda/fałsz)

Adermatoglifia to bardzo rzadkie zaburzenie genetyczne. Powoduje ono, że dana osoba nie ma linii papilarnych, a więc nie pozostawia charakterystycznych odcisków palców. Poza tym osoby z adermatoglifią są całkowicie zdrowe, w niewielkim stopniu zredukowana jest tylko u nich liczba gruczołów potowych.

Przyczyną adermatoglifii jest mutacja genu SMARCAD1, który ma swój locus w czwartym chromosomie. Ta mutacja jest substytucją, która zaburza splicing (składanie genu) i uniemożliwia syntezę prawidłowego białka niezbędnego do wytworzenia linii papilarnych. Pomimo że do wystąpienia adermatoglifii wystarczy jeden zmutowany allel, stwierdzono ją dotychczas tylko w kilku rodzinach na świecie.

Inną przyczyną braku linii papilarnych jest mutacja genu KTR14. Efektem tej mutacji jest choroba DPR (łac. dermatopathia pigmentosa reticularis). Osoby dotknięte DPR, oprócz braku linii papilarnych, charakteryzują się cieńszymi i łamliwymi włosami, oraz nierówną pigmentacją skóry.

Na podstawie: http://www.omim.org/entry;
https://ghr.nlm.nih.gov/condition/adermatoglyphia.

19.1. (0–1)

Zaznacz poprawne dokończenie poniższego zdania – wybierz odpowiedź spośród A–B oraz odpowiedź spośród 1.–2.

Allel wywołujący adermatoglifię, w stosunku do allelu niepowodującego tego zaburzenia, jest

A. dominujący, a ta choroba występuje u kobiet i mężczyzn 1. z taką samą częstością.
B. recesywny, 2. z różną częstością.

19.2. (0–1)

Wyjaśnij, dlaczego w przypadku adermatoglifii, w odróżnieniu od DPR, mówi się raczej o zaburzeniu genetycznym, a nie – o chorobie genetycznej. W odpowiedzi odwołaj się do efektów fenotypowych.

19.3. (0–1)

Określ, który z genów – gen warunkujący adermatoglifię czy gen warunkujący DPR – ma silniejszy efekt plejotropowy. Odpowiedź uzasadnij.

19.4. (0–1)

Oceń, czy poniższe stwierdzenia dotyczące adermatoglifii są prawdziwe. Zaznacz P, jeśli stwierdzenie jest prawdziwe, albo F – jeśli jest fałszywe.

1. W adermatoglifii zaburzony jest proces wycinania intronów. P F
2. Adermatoglifia jest spowodowana mutacją punktową. P F
3. Mężczyźni mogą być bezobjawowymi nosicielami allelu adermatoglifii. P F

19.5. (0–1)

Określ, jakie znaczenie adaptacyjne miało w toku ewolucji pojawienie się u naczelnych linii papilarnych na wewnętrznych powierzchniach dłoni i stóp.

Matura Lipiec 2020, Poziom rozszerzony (Formuła 2015)Zadanie 18. (5 pkt)

Dziedziczenie Ekspresja informacji genetycznej Mutacje Ewolucjonizm i historia życia na ziemi Podaj i uzasadnij/wyjaśnij Podaj/wymień

Dystrofia mięśniowa Duchenne'a jest najczęstszą i najcięższą z postępujących dystrofii mięśniowych. Jest to choroba genetycznie uwarunkowana – dziedziczy się w sposób recesywny sprzężony z płcią. Wynikiem obecności nieprawidłowego allelu d genu DMD, jest synteza nieprawidłowej dystrofiny w komórce mięśniowej – białka tworzącego ,,szkielet" komórki mięśniowej. Chorzy umierają zwykle w wieku przedreprodukcyjnym.

Poniżej na schemacie przedstawiono fragment sekwencji nukleotydowej DNA (poszczególne kodony zostały oddzielone przerwami) prawidłowego (I) i zmutowanego genu DMD (II). Zamieszczone fragmenty nie zawierają intronów.

I. Fragment prawidłowej sekwencji nici kodującej:
5’ CAG CAG CAG CAG CAG 3’

II. Fragment sekwencji nici kodującej, w której występuje mutacja:
5’ CAG CAG TAG CAG CAG 3’

18.1. (0–1)

Wpisz, posługując się trójliterowymi skrótami nazw aminokwasów, w wykropkowane miejsca na schemacie sekwencję kodowanego fragmentu białka, zakodowanego w zapisanych fragmentach DNA I i II genu DMD.

18.2. (0–1)

Na podstawie sekwencji I i II genu DMD określ rodzaj mutacji genowej warunkującej rozwój dystrofii mięśniowej Duchenne’a.

18.3. (0–1)

Określ, jakie będą skutki przedstawionej mutacji dla pierwszorzędowej struktury białka, w porównaniu z jego prawidłową strukturą.

18.4. (0–1)

Wyjaśnij, dlaczego mimo działania doboru naturalnego w populacji ludzkiej utrzymuje się allel warunkujący zespół Duchenne’a.

18.5. (0–2)

Określ, jakie jest prawdopodobieństwo, że kolejne dziecko zdrowych rodziców, którzy mają już jednego syna chorego na dystrofię mięśniową typu Duchenne’a, będzie chore na tę chorobę. W odpowiedzi uwzględnij genotypy rodziców oraz zapisz krzyżówkę genetyczną lub obliczenia.

Prawdopodobieństwo, że kolejne dziecko tych rodziców będzie chore: %

Matura Lipiec 2020, Poziom rozszerzony (Formuła 2015)Zadanie 5. (6 pkt)

Prokarionty Wirusy, wiroidy, priony Ewolucjonizm i historia życia na ziemi Inżynieria i badania genetyczne Podaj i uzasadnij/wyjaśnij Podaj/wymień

Transfer materiału genetycznego (DNA) między komórkami bakterii odbywa się na drodze koniugacji, transdukcji lub transformacji:

  • koniugacja – polega na jednokierunkowym transferze plazmidowego DNA z jednej komórki bakteryjnej do drugiej;
  • transdukcja – zachodzi z udziałem wirusów;
  • transformacja – polega na pobieraniu przez bakterie materiału genetycznego ze środowiska.
Na podstawie: U. Kasprzykowska, M. Sobieszczańska, Plastyczność bakteryjnych genomów – międzykomórkowy transfer informacji genetycznej, „ Postępy mikrobiologii”, 53 (2) 2014.

5.1. (0–1)

Uporządkuj przedstawione poniżej etapy koniugacji bakterii (A– E) w kolejności ilustrującej przebieg tego procesu.

Kolejność:

5.2. (0–1)

Uzasadnij, że do przekazania informacji genetycznej zapisanej w plazmidzie, na drodze koniugacji, wystarczy przeniesienie do komórki – biorcy tylko jednej nici DNA plazmidowego.

5.3. (0–1)

Uzasadnij, że bakteria, która jest biorcą DNA plazmidowego w procesie koniugacji, może odnieść korzyści z tego procesu. W odpowiedzi uwzględnij przykład takiej korzyści.

5.4. (0–1)

Uzasadnij, że bakteriofagi mogą być wektorami przenoszącymi DNA pomiędzy komórkami bakterii.

5.5. (0–1)

Wyjaśnij, dlaczego intensywna międzykomórkowa wymiana informacji genetycznej zachodząca w populacji bakterii zapewnia tym mikroorganizmom bardzo szybkie tempo ewolucji adaptacyjnej.

5.6. (0–1)

Do podanych w tabeli cech wektora plazmidowego 1.–3., wykorzystywanego przy wprowadzaniu obcego DNA do komórek bakterii, przyporządkuj spośród A–D po jednym jego znaczeniu w tym procesie.

  1. Umożliwia rozdzielenie wektorów do komórek potomnych.
  2. Umożliwia selekcję szczepów, które pobrały plazmid.
  3. Umożliwia włączenie obcego DNA do wektora plazmidowego.
  4. Ułatwia miejscowe rozplecenie helisy DNA.
Cecha wektora plazmidowego Znaczenie podczas wprowadzania DNA do bakterii
1. Miejsce inicjacji replikacji bogate w pary AT, a nie – w pary CG.
2. Obecność fragmentu z wieloma miejscami rozpoznawalnymi przez enzymy restrykcyjne.
3. Obecność genu oporności na określony antybiotyk.

Matura Czerwiec 2021, Poziom rozszerzony (Formuła 2015)Zadanie 18. (4 pkt)

Ekspresja informacji genetycznej Mutacje Uzupełnij/narysuj wykres, schemat lub tabelę Podaj/wymień

Na schemacie przedstawiono, w uproszczony sposób, syntezę pewnego peptydu.

Na podstawie: https://en.wikipedia.org/wiki/Ribosomal_pause#/media/File:Peptide_syn.png

18.1. (0–1)

Uzupełnij powyższy schemat.

  1. Wpisz w puste prostokąty odpowiednie oznaczenia (3ʹ lub 5ʹ) obu końców nici cząsteczki mRNA.
  2. Dorysuj do linii grot strzałki wskazującej kierunek odczytu informacji genetycznej.

18.2. (0–1)

Zapisz kodon, oznaczony na schemacie literami XYZ, kodujący metioninę rozpoczynającą ten peptyd, oraz podaj nazwę aminokwasu oznaczonego na schemacie literą α, który jako kolejny zostanie dołączony do syntezowanego peptydu.

  1. Kodon XYZ:
  2. Aminokwas α:

18.3. (0–1)

Określ, z ilu aminokwasów będzie ostatecznie zbudowany ten peptyd, jeżeli po translacji metionina zostanie odcięta.

Liczba aminokwasów budujących peptyd:

18.4. (0–1)

We fragmencie DNA, w którym jest zapisana sekwencja aminokwasowa przedstawionego peptydu, doszło w nici kodującej do podstawienia adeniny na guaninę w trzeciej pozycji kodonu kodującego lizynę.

Określ skutek tej mutacji na poziomie sekwencji aminokwasowej peptydu.

Matura Czerwiec 2021, Poziom rozszerzony (Formuła 2015)Zadanie 16. (4 pkt)

Dziedziczenie Podaj/wymień Podaj i uzasadnij/wyjaśnij

Za barwę upierzenia papużek falistych odpowiadają allele dwóch dopełniających się genów autosomalnych, które dziedziczą się niezależnie. Dominujący allel F warunkuje kolor niebieski, natomiast allel G – kolor żółty. Papużki mające co najmniej po jednym allelu dominującym obydwu genów są zielone, natomiast osobniki będące podwójnymi homozygotami recesywnymi są białe.

Potomstwo pary papużek falistych – niebieskiej i żółtej – było zawsze upierzone zielono. Jednak kiedy krzyżowano te zielone ptaki z F1 z innymi osobnikami zielonymi, otrzymywano w F2 ptaki: zielone, niebieskie, żółte, a czasami białe.

Na podstawie: B. Kosowska, Genetyka ogólna i weterynaryjna, Wrocław 2010.

16.1. (0–1)

Zapisz, stosując oznaczenia alleli podane w tekście, genotypy opisanej pary papużek falistych – niebieskiej i żółtej – oraz ich potomstwa (F1) o piórach zielonych.

Genotyp osobnika niebieskiego:
Genotyp osobnika żółtego:
Genotyp ich zielonego potomstwa (F1):

16.2. (0–1)

Zapisz, stosując oznaczenia alleli podane w tekście, wszystkie możliwe genotypy zielonych papużek falistych.

16.3. (0–2)

Określ prawdopodobieństwo (w %) pojawienia się białego osobnika wśród potomstwa białej papużki falistej i zielonego ptaka z pokolenia F1. Odpowiedź uzasadnij, zapisując odpowiednią krzyżówkę genetyczną (szachownicę Punnetta).

Prawdopodobieństwo: %

Informator CKE, Poziom rozszerzony (Formuła 2023)Zadanie 15. (1 pkt)

Inżynieria i badania genetyczne Podaj i uzasadnij/wyjaśnij
Zadanie anulowane przez CKE jako niezgodne z wymaganiami egzaminacyjnymi

Indukowane pluripotencjalne komórki macierzyste (komórki iPS) są pozyskiwane z komórek somatycznych, takich jak fibroblasty. W 2014 r. po raz pierwszy wszczepiono warstwę barwnikową siatkówki przygotowaną z komórek iPS w ramach leczenia zwyrodnienia plamki żółtej. Wcześniej nie stosowano przeszczepu siatkówki w leczeniu tego schorzenia.

Na podstawie: https://www.riken.jp/pr/news/2014/20140918_1/

Uzasadnij, że wszczepienie warstwy barwnikowej siatkówki otrzymanej z komórek iPS pacjenta, a nie – innego dawcy, jest korzystne dla tego pacjenta.

Informator CKE, Poziom rozszerzony (Formuła 2023)Zadanie 14. (8 pkt)

Układ immunologiczny Choroby człowieka Ekspresja informacji genetycznej Metody badawcze i doświadczenia Uzupełnij/narysuj wykres, schemat lub tabelę Zamknięte (np. testowe, prawda/fałsz) Podaj i uzasadnij/wyjaśnij

Współcześnie stosuje się dwie podstawowe metody wykrywania zakażeń HIV. Rutynowe badanie polega na wykrywaniu przeciwciał anty-HIV w surowicy pacjenta. W przypadku tej metody czułość badania, czyli prawdopodobieństwo otrzymania wyniku dodatniego u osoby chorej, tzn. wykrycia zakażenia, wynosi 100%, ale wynik dodatni otrzymuje się także dla 0,5% zdrowych osób – specyficzność wynosi 99,5%. Dlatego postawienie diagnozy zakażenia HIV wymaga potwierdzenia dodatkowym badaniem za pomocą metody PCR, wykrywającym gen odwrotnej transkryptazy wbudowany w genom gospodarza. Ta metoda jest teoretycznie bezbłędna pod warunkiem utrzymywania wysokich standardów pracy laboratoryjnej. Odpowiednie próby kontrolne służą sprawdzeniu, czy:

  • polimeraza DNA nie utraciła aktywności podczas przechowywania (kontrola pozytywna),
  • wszystkie odczynniki są wolne od wirusowego materiału genetycznego (kontrola negatywna).

Dla trzech pacjentów uzyskano dodatni wynik testu na obecność przeciwciał anty-HIV. Z tego powodu lekarz zlecił dodatkowe badanie z wykorzystaniem metody PCR, którego wyniki podsumowano w poniższej tabeli.

Próba
badawcza kontrolna pozytywna kontrolna negatywna
Pacjent 1. +
Pacjent 2. + + +
Pacjent 3. + +
Na podstawie: GenBank sekwencja nr KR861191.1;
M. Fearon, The Laboratory Diagnosis of HIV Infections, „Can J Dis Med Microbiol” 16, 2005, s. 26–30;
D.S Boyle i inni, Rapid Detection of HIV-1 Proviral DNA for Early Infant Diagnosis Using Recombinase Polymerase Amplification, „mBio” 4, 2013, e00135–13;
S. Koblavi-Dème i inni, Sensitivity and Specificity of Human Immunodeficiency Virus Rapid Serologic Assays and Testing Algorithms in an Antenatal Clinic in Abidjan, Ivory Coast, „J Clin Microbiol” 39, 2001, s. 1808–1812.

14.1. (0–2)

Zaprojektuj doświadczenie PCR wykrywające DNA HIV wbudowane w genom gospodarza. Dla każdej z prób – badawczej, kontrolnej pozytywnej i kontrolnej negatywnej – wybierz wszystkie właściwe składniki mieszaniny reakcyjnej. Wpisz w tabelę znak „+”, jeśli składnik należy dodać do próby, albo znak „–”, jeśli ten składnik należy pominąć.

Próba
badawcza kontrolna pozytywna kontrolna negatywna
DNA genomowy wyizolowany od pacjenta
DNA genomowy wyizolowany z linii komórkowej zakażonej HIV
para specyficznych starterów
bufor zapewniający optymalne pH i stężenie jonów Mg2+
termostabilna polimeraza DNA
mieszanina deoksyrybonukleotydów

14.2. (0–1)

Wybierz spośród A–D i zaznacz prawidłowe sekwencje starterów polF1 i polR1, wykorzystywanych w teście diagnostycznym HIV, przyłączających się do zaznaczonych fragmentów poniższej sekwencji genu odwrotnej transkryptazy wirusa HIV, wbudowanej w genom gospodarza.

  1. polF1 5′ CCCTACAATCCCCAAAGTCAAGGAGTAGTAGAA 3′
    polR1 5′ CTCTGGAAAGGTGAAGGGGCAGTAGTAATACA 3′
  2. polF1 5′ TTCTACTACTCCTTGACTTTGGGGATTGTAGGG 3′
    polR1 5′ TGTATTACTACTGCCCCTTCACCTTTCCAGAG 3′
  3. polF1 5′ CCCTACAATCCCCAAAGTCAAGGAGTAGTAGAA 3′
    polR1 5′ TGTATTACTACTGCCCCTTCACCTTTCCAGAG 3′
  4. polF1 5′ TTCTACTACTCCTTGACTTTGGGGATTGTAGGG 3′
    polR1 5′ CTCTGGAAAGGTGAAGGGGCAGTAGTAATACA 3′

14.3. (0–2)

Podpunkt anulowany przez CKE

Przed zabiegiem chirurgicznym pacjentowi wykonano testy na nosicielstwo wirusa HIV wykrywające przeciwciała anty-HIV. Wynik wyszedł dodatni. Pacjent nie znajduje się w żadnej z grup ryzyka zakażenia HIV. Według oficjalnych danych częstość występowania zakażenia HIV w Polsce wynosi ok. 40 osób na 100 tys.

Oblicz prawdopodobieństwo, że pacjent jest zakażony HIV, z uwzględnieniem czułości i specyficzności testu na przeciwciała anty-HIV. Zapisz obliczenia w wyznaczonych miejscach 1.–3.

  1. Oczekiwana liczba osób zakażonych HIV, u których wynik testu na przeciwciała anty-HIV będzie dodatni, wśród 100 tys. losowo przebadanych osób:
  2. Oczekiwana liczba osób zdrowych (niezakażonych), u których wynik testu na przeciwciała anty-HIV będzie dodatni, wśród 100 tys. losowo przebadanych osób:
  3. Prawdopodobieństwo, że pacjent z dodatnim wynikiem testu na przeciwciała anty-HIV jest zakażony HIV:

14.4. (0–1)

Oceń, czy poniższe interpretacje przedstawionych wyników badań trojga pacjentów są prawidłowe. Zaznacz T (tak), jeśli interpretacja jest prawidłowa, albo N (nie) – jeśli jest nieprawidłowa.

1. U pacjenta 1. wynik testu na przeciwciała anty-HIV był fałszywie dodatni, o czym świadczy wykluczenie zakażenia na podstawie wyników PCR. T N
2. Wyniki testu PCR dla pacjenta 2. są niewiarygodne ze względu na dodatni wynik w próbie kontrolnej negatywnej – należy powtórzyć badanie. T N
3. Dodatkowe badanie techniką PCR potwierdziło podejrzenie, że pacjent 3. jest zakażony HIV. T N

14.5. (0–1)

Wyjaśnij, dlaczego testy wykrywające przeciwciała anty-HIV nie nadają się do diagnostyki zakażeń HIV u noworodków i niemowląt urodzonych przez matki zakażone HIV. W odpowiedzi uwzględnij spodziewany wynik testu oraz funkcjonowanie układu odpornościowego matki.

14.6. (0–1)

Oceń, czy poniższe osoby znajdują się w grupie zwiększonego ryzyka zakażenia HIV. Zaznacz T (tak), jeśli się w niej znajdują, albo N (nie) – jeśli w niej się nie znajdują.

1. Osoby przebywające w jednym pomieszczeniu z osobami zakażonymi HIV, np. w pracy lub szkole. T N
2. Osoby narażone na częste ukąszenia komarów i innych owadów odżywiających się krwią. T N
3. Sąsiedzi osób zakażonych HIV, mieszkający w tym samym domu wielorodzinnym. T N

Informator CKE, Poziom rozszerzony (Formuła 2023)Zadanie 13. (4 pkt)

Dziedziczenie Podaj i uzasadnij/wyjaśnij Podaj/wymień

Umaszczenie świń rasy duroc jest warunkowane przez dwie pary alleli genów autosomalnych (B i b oraz D i d) dziedziczonych niezależnie i współdziałających ze sobą. U osobników tej rasy występują trzy rodzaje umaszczenia: ciemnorudy, piaskowy i biały. Do wytworzenia barwnika ciemnorudego konieczny jest co najmniej jeden allel dominujący z każdej pary. Podwójne homozygoty recesywne są białe, natomiast umaszczenie piaskowe mają osobniki, w których genotypie występują dwa allele recesywne tylko jednego z genów warunkujących umaszczenie.

Na podstawie: B. Kosowska, Genetyka ogólna i weterynaryjna, Wrocław 2010, s. 25.

13.1. (0–1)

Zapisz, stosując podane w tekście oznaczenia alleli genów odpowiedzialnych za umaszczenie, genotypy pary świń rasy duroc – piaskowej samicy i piaskowego samca, których potomstwo zawsze będzie ciemnorude.

Genotyp samicy:
Genotyp samca:

13.2. (0–3)

Określ prawdopodobieństwo, że kolejny potomek ciemnorudej samicy i białego samca, których potomstwo stanowią prosięta ciemnorude, piaskowe oraz białe, będzie miał umaszczenie piaskowe. Odpowiedź uzasadnij, zapisując krzyżówkę genetyczną lub obliczenia z komentarzem przedstawiającym tok rozumowania.

Strony