Układ immunologiczny

Oto lista zadań maturalnych z danego działu biologii. Aby skorzystać z dodatkowych opcji lub wybrać zadania z pozostałych działów kliknij poniżej.

Przejdź do wyszukiwarki zadań

 

Matura Czerwiec 2021, Poziom rozszerzony (Formuła 2015)Zadanie 14. (2 pkt)

Układ immunologiczny Choroby człowieka Podaj i uzasadnij/wyjaśnij

Wirusowe zapalenie wątroby typu C (WZW C) jest wywoływane zakażeniem przez wirus zapalenia wątroby typu C (HCV). Źródłem zakażenia jest krew. Warunkiem przeniesienia zakażenia na inną osobę jest naruszenie ciągłości tkanek (przekłucie lub uszkodzenie skóry lub błony śluzowej), przez które wirus może dostać się do krwi. Jedną z zasad profilaktyki zakażenia HCV jest używanie rękawiczek ochronnych przez personel medyczny, kosmetyczki, czy inne osoby, które w związku z wykonywaną pracą mogą mieć kontakt z krwią innych ludzi. Aby zdiagnozować zakażenie HCV, w pierwszej kolejności wykonuje się badanie krwi pacjenta, mające na celu wykrycie przeciwciał anty-HCV. Jednak nie zawsze obecność przeciwciał anty-HCV we krwi świadczy o aktywnym zakażeniu wirusem HCV. Z tego powodu po wykryciu przeciwciał anty-HCV wykonuje się kolejne badanie, czyli test na obecność materiału genetycznego tego wirusa (RNA HCV). Dodatni wynik tego testu oznacza, że we krwi wykazana została obecność materiału genetycznego HCV, co świadczy o aktywnym zakażeniu, a u pacjenta może rozwinąć się zapalenie wątroby.

Wiele osób zakażonych HCV przez długi czas nie ma objawów choroby i czuje się dobrze. Niestety do tej pory nie ma dostępnej skutecznej szczepionki przeciw HCV.

Na podstawie: http://www.hcv.pzh.gov.pl

14.1. (0–1)

Wyjaśnij, dlaczego obecność przeciwciał anty-HCV we krwi badanej osoby nie zawsze świadczy o obecności tego wirusa w organizmie tej osoby.

14.2. (0–1)

Uzasadnij, że w celu zapobiegania zakażeniu HCV nie wystarczy, aby osoba pobierająca krew pracowała w rękawiczkach ochronnych, ale powinna zmieniać te rękawiczki po każdym pacjencie.

Informator CKE, Poziom rozszerzony (Formuła 2023)Zadanie 14. (8 pkt)

Układ immunologiczny Choroby człowieka Ekspresja informacji genetycznej Metody badawcze i doświadczenia Uzupełnij/narysuj wykres, schemat lub tabelę Zamknięte (np. testowe, prawda/fałsz) Podaj i uzasadnij/wyjaśnij

Współcześnie stosuje się dwie podstawowe metody wykrywania zakażeń HIV. Rutynowe badanie polega na wykrywaniu przeciwciał anty-HIV w surowicy pacjenta. W przypadku tej metody czułość badania, czyli prawdopodobieństwo otrzymania wyniku dodatniego u osoby chorej, tzn. wykrycia zakażenia, wynosi 100%, ale wynik dodatni otrzymuje się także dla 0,5% zdrowych osób – specyficzność wynosi 99,5%. Dlatego postawienie diagnozy zakażenia HIV wymaga potwierdzenia dodatkowym badaniem za pomocą metody PCR, wykrywającym gen odwrotnej transkryptazy wbudowany w genom gospodarza. Ta metoda jest teoretycznie bezbłędna pod warunkiem utrzymywania wysokich standardów pracy laboratoryjnej. Odpowiednie próby kontrolne służą sprawdzeniu, czy:

  • polimeraza DNA nie utraciła aktywności podczas przechowywania (kontrola pozytywna),
  • wszystkie odczynniki są wolne od wirusowego materiału genetycznego (kontrola negatywna).

Dla trzech pacjentów uzyskano dodatni wynik testu na obecność przeciwciał anty-HIV. Z tego powodu lekarz zlecił dodatkowe badanie z wykorzystaniem metody PCR, którego wyniki podsumowano w poniższej tabeli.

Próba
badawcza kontrolna pozytywna kontrolna negatywna
Pacjent 1. +
Pacjent 2. + + +
Pacjent 3. + +

Na podstawie: GenBank sekwencja nr KR861191.1; M. Fearon, The Laboratory Diagnosis of HIV Infections, „Can J Dis Med Microbiol” 16, 2005, s. 26–30;
D.S Boyle i inni, Rapid Detection of HIV-1 Proviral DNA for Early Infant Diagnosis Using Recombinase Polymerase Amplification, „mBio” 4, 2013, e00135–13;
S. Koblavi-Dème i inni, Sensitivity and Specificity of Human Immunodeficiency Virus Rapid Serologic Assays and Testing Algorithms in an Antenatal Clinic in Abidjan, Ivory Coast, „J Clin Microbiol” 39, 2001, s. 1808–1812.

14.1. (0–2)

Zaprojektuj doświadczenie PCR wykrywające DNA HIV wbudowane w genom gospodarza. Dla każdej z prób – badawczej, kontrolnej pozytywnej i kontrolnej negatywnej – wybierz wszystkie właściwe składniki mieszaniny reakcyjnej. Wpisz w tabelę znak „+”, jeśli składnik należy dodać do próby, albo znak „–”, jeśli ten składnik należy pominąć.

Próba
badawcza kontrolna pozytywna kontrolna negatywna
DNA genomowy wyizolowany od pacjenta
DNA genomowy wyizolowany z linii komórkowej zakażonej HIV
para specyficznych starterów
bufor zapewniający optymalne pH i stężenie jonów Mg2+
termostabilna polimeraza DNA
mieszanina deoksyrybonukleotydów

14.2. (0–1)

Wybierz spośród A–D i zaznacz prawidłowe sekwencje starterów polF1 i polR1, wykorzystywanych w teście diagnostycznym HIV, przyłączających się do zaznaczonych fragmentów poniższej sekwencji genu odwrotnej transkryptazy wirusa HIV, wbudowanej w genom gospodarza.

  1. polF1 5′ CCCTACAATCCCCAAAGTCAAGGAGTAGTAGAA 3′
    polR1 5′ CTCTGGAAAGGTGAAGGGGCAGTAGTAATACA 3′
  2. polF1 5′ TTCTACTACTCCTTGACTTTGGGGATTGTAGGG 3′
    polR1 5′ TGTATTACTACTGCCCCTTCACCTTTCCAGAG 3′
  3. polF1 5′ CCCTACAATCCCCAAAGTCAAGGAGTAGTAGAA 3′
    polR1 5′ TGTATTACTACTGCCCCTTCACCTTTCCAGAG 3′
  4. polF1 5′ TTCTACTACTCCTTGACTTTGGGGATTGTAGGG 3′
    polR1 5′ CTCTGGAAAGGTGAAGGGGCAGTAGTAATACA 3′

14.3. (0–2)

Podpunkt anulowany przez CKE

Przed zabiegiem chirurgicznym pacjentowi wykonano testy na nosicielstwo wirusa HIV wykrywające przeciwciała anty-HIV. Wynik wyszedł dodatni. Pacjent nie znajduje się w żadnej z grup ryzyka zakażenia HIV. Według oficjalnych danych częstość występowania zakażenia HIV w Polsce wynosi ok. 40 osób na 100 tys.

Oblicz prawdopodobieństwo, że pacjent jest zakażony HIV, z uwzględnieniem czułości i specyficzności testu na przeciwciała anty-HIV. Zapisz obliczenia w wyznaczonych miejscach 1.–3.

  1. Oczekiwana liczba osób zakażonych HIV, u których wynik testu na przeciwciała anty-HIV będzie dodatni, wśród 100 tys. losowo przebadanych osób:
  2. Oczekiwana liczba osób zdrowych (niezakażonych), u których wynik testu na przeciwciała anty-HIV będzie dodatni, wśród 100 tys. losowo przebadanych osób:
  3. Prawdopodobieństwo, że pacjent z dodatnim wynikiem testu na przeciwciała anty-HIV jest zakażony HIV:

14.4. (0–1)

Oceń, czy poniższe interpretacje przedstawionych wyników badań trojga pacjentów są prawidłowe. Zaznacz T (tak), jeśli interpretacja jest prawidłowa, albo N (nie) – jeśli jest nieprawidłowa.

1. U pacjenta 1. wynik testu na przeciwciała anty-HIV był fałszywie dodatni, o czym świadczy wykluczenie zakażenia na podstawie wyników PCR. T N
2. Wyniki testu PCR dla pacjenta 2. są niewiarygodne ze względu na dodatni wynik w próbie kontrolnej negatywnej – należy powtórzyć badanie. T N
3. Dodatkowe badanie techniką PCR potwierdziło podejrzenie, że pacjent 3. jest zakażony HIV. T N

14.5. (0–1)

Wyjaśnij, dlaczego testy wykrywające przeciwciała anty-HIV nie nadają się do diagnostyki zakażeń HIV u noworodków i niemowląt urodzonych przez matki zakażone HIV. W odpowiedzi uwzględnij spodziewany wynik testu oraz funkcjonowanie układu odpornościowego matki.

14.6. (0–1)

Oceń, czy poniższe osoby znajdują się w grupie zwiększonego ryzyka zakażenia HIV. Zaznacz T (tak), jeśli się w niej znajdują, albo N (nie) – jeśli w niej się nie znajdują.

1. Osoby przebywające w jednym pomieszczeniu z osobami zakażonymi HIV, np. w pracy lub szkole. T N
2. Osoby narażone na częste ukąszenia komarów i innych owadów odżywiających się krwią. T N
3. Sąsiedzi osób zakażonych HIV, mieszkający w tym samym domu wielorodzinnym. T N

Biomedica 2022, Poziom rozszerzony (Formuła 2015)Zadanie 25. (2 pkt)

Układ immunologiczny Zamknięte (np. testowe, prawda/fałsz)

Uzupełnij poniższy tekst tak, aby stanowił poprawną całość, podkreślając właściwy wyraz.

Immunoglobuliny występują w płynach ustrojowych wszystkich kręgowców / bezkręgowców. Wyróżniamy pięć klas immunoglobulin: IgA, IgE, IgG, IgD, IgM. Immunoglobuliny wykazują / nie wykazują powinowactwa do antygenów. Immunoglobuliny są wytwarzane przez plazmocyty będące pobudzonymi limfocytami T / B. Immunoglobuliny mogą wiązać / nie mogą wiązać toksyn(y). Immunoglobuliny odpowiadają / nie odpowiadają za indukcję immunofagocytozy. Przeciwciała należą do odpowiedzi immunologicznej nieswoistej / swoistej.

To zadanie pochodzi ze zbioru matura 2022 wydawnictwa Biomedica
Kup pełny zbiór zadań

Informator CKE, Poziom rozszerzony (Formuła 2023)Zadanie 1. (4 pkt)

Skład organizmów Budowa i funkcje komórki Układ immunologiczny Zamknięte (np. testowe, prawda/fałsz) Podaj i uzasadnij/wyjaśnij

U ssaków przeciwciała produkowane przez matkę mogą zostać przekazane potomstwu nie tylko w czasie życia płodowego, lecz także po urodzeniu. Zawarte w mleku matki przeciwciała klasy IgG mogą przedostać się przez nabłonek jelita do krwiobiegu niemowlęcia, ale przeciwciała klasy IgA są wchłaniane do enterocytów tylko w niewielkim stopniu, gdzie są następnie trawione.

Selektywny transport przeciwciał umożliwia białko FcRn, składające się z dwóch niekowalencyjnie związanych łańcuchów: ciężkiego H oraz lekkiego L. Przechodzi ono modyfikacje potranslacyjne – do co najmniej jednego aminokwasu są dołączane reszty cukrowe. Białko FcRn pełni funkcję receptora na powierzchni błony enterocytu, a jego powinowactwo do przeciwciał jest zależne od pH środowiska. U młodych ssaków treść dwunastnicy i jelita czczego ma kwaśny odczyn, a więc niższy niż fizjologiczne pH krwi. Transport przeciwciał zilustrowano na poniższym schemacie.

Na podstawie: M. Pyzik i inni, The Architect Behind the Immune and Nonimmune Functions of IgG and Albumin, „Journal of Immunlogy” 194, 2015, s. 4595–4603.

1.1. (0–1)

Wybierz i zaznacz makroelement, który może wejść w skład białka wyłącznie w wyniku modyfikacji potranslacyjnej.

  1. węgiel
  2. wodór
  3. azot
  4. tlen
  5. fosfor
  6. siarka

1.2. (0–1)

Na podstawie przedstawionych we wstępie do zadania informacji określ najwyższą rzędowość struktury białka FcRn. Odpowiedź uzasadnij, odwołując się do cechy budowy tego białka.

1.3. (0–1)

Uzupełnij poniższe zdanie tak, aby powstał poprawny opis transportu przeciwciał przez komórkę nabłonka jelita z mleka matki do krwiobiegu niemowlęcia. W każdym nawiasie podkreśl właściwe określenie.

Przeciwciała dostają się z treści jelita niemowlęcia do wnętrza enterocytu na zasadzie (dyfuzji wspomaganej / endocytozy), a następnie wydostają się z niego do jego krwiobiegu w procesie (dyfuzji prostej / egzocytozy).

1.4. (0–1)

Wyjaśnij, dlaczego przez barierę jelitową do krwiobiegu niemowlęcia przedostają się wyłącznie przeciwciała klasy IgG, mimo że w mleku matki są zawarte także przeciwciała klasy IgA. W odpowiedzi uwzględnij rolę białka FcRn.

Matura Maj 2020, Poziom rozszerzony (Formuła 2007)Zadanie 5. (3 pkt)

Budowa i funkcje komórki Układ immunologiczny Podaj i uzasadnij/wyjaśnij Zamknięte (np. testowe, prawda/fałsz)

Na rysunku I przedstawiono budowę limfocytu B, a na rysunku II przedstawiono budowę plazmocytu, który powstał z tego limfocytu. Funkcje plazmocytu to produkcja i wydzielanie przeciwciał. Obie komórki zostały poddane barwieniu w celu uwidocznienia struktur komórkowych.

Uwaga: Zachowano proporcje wielkości obu komórek.

Na podstawie: Z. Bielańska-Osuchowska, J. Kawiak, Struktura funkcjonalna komórek i tkanek, Warszawa 1991.

a)Na podstawie analizy rysunków wskaż dwie różnice w budowie wewnętrznej plazmocytu w porównaniu z limfocytem B.
b)Na przykładzie jednej cechy wykaż związek między budową plazmocytu a jego funkcją związaną z wytwarzaniem przeciwciał.
c)Spośród wymienionych cech wybierz i zaznacz trzy cechy odporności uzyskiwanej przez człowieka dzięki podaniu surowicy zawierającej przeciwciała.
  1. swoista
  2. nieswoista
  3. bierna
  4. czynna
  5. naturalna
  6. sztuczna

Zbiór zadań CKE, Poziom rozszerzony (Formuła 2015)Zadanie 91. (4 pkt)

Dziedziczenie Układ immunologiczny Podaj/wymień Zamknięte (np. testowe, prawda/fałsz) Podaj i uzasadnij/wyjaśnij

Grupa krwi człowieka w układzie AB0 zależy od dziedziczenia jednego z trzech alleli (IA, IB lub i). Allele IA oraz IB są kodominujące w stosunku do siebie oraz dominujące w stosunku do allelu i. Innym ważnym układem antygenowym jest czynnik Rh. Na powierzchni erytrocytów ludzi z grupą krwi Rh+ występuje antygen D, a u osób z grupą Rh– brak jest tego antygenu. Allel warunkujący obecność antygenu D jest dominujący, cecha ta dziedziczy się zgodnie z I prawem Mendla.
Matka, ma grupę krwi AB Rh+, zaś ojciec ma grupę krwi 0 Rh–.

a)Oceń, czy u dziecka tej pary może wystąpić grupa krwi A Rh–. Zapisz genotypy rodziców oraz uzupełnij szachownicę Punnetta.

Genotypy rodziców:

Odpowiedź:

b)Oceń prawdziwość podanych stwierdzeń dotyczących dziedziczenia czynnika Rh. Wpisz znak X w odpowiednie komórki tabeli.
Lp. Informacja Prawda Fałsz
1. Osoby posiadające allel dominujący (D) zawsze mają grupę krwi Rh+.
2. Kobieta o genotypie DD i mężczyzna o genotypie Dd mogą mieć dziecko z grupą krwi Rh–.
3. Prawdopodobieństwo, że dziecko pary o genotypach Dd będzie miało grupę krwi Rh–, jest równe 50%.
c)Określ, czy podczas ciąży u opisanej kobiety może wystąpić konflikt serologiczny. Odpowiedź uzasadnij.

Zbiór zadań CKE, Poziom rozszerzony (Formuła 2015)Zadanie 75. (6 pkt)

Układ immunologiczny Dziedziczenie Zamknięte (np. testowe, prawda/fałsz) Podaj i uzasadnij/wyjaśnij

Głównymi antygenami transplantacyjnymi człowieka są antygeny grupowe AB0 występujące na erytrocytach oraz antygeny głównego układu zgodności tkankowej HLA, które występują na powierzchni wszystkich komórek jądrzastych. Jeżeli występuje niezgodność antygenów, to zostaje zainicjowana reakcja odpornościowa, która jest przyczyną odrzucenia przeszczepu. Liczne geny układu HLA znajdują się w 6. chromosomie, ale między nimi rzadko dochodzi do crossing-over, dlatego zwykle geny te dziedziczą się razem, co jest ważne dla przeszczepów rodzinnych. Zestaw alleli genów znajdujący się w tym samym chromosomie i razem dziedziczony zwany jest haplotypem. Każda komórka w organizmie potomka posiada na swojej powierzchni cząsteczki HLA zarówno typu matczynego, jak i ojcowskiego. Na schemacie przedstawiono dziedziczenie genów HLA.

Na podstawie: P.M. Lydyard, A. Whelan, M.W. Fanger, Immunologia. Krótkie wykłady, Warszawa 2009, s. 277.

a)Korzystając ze schematu, uzupełnij poniższe zdania, wybierając wartość liczbową spośród: 25, 50, 75, 100.

Przeszczepy narządów od rodzica do dziecka i odwrotnie wykazują % zgodnych alelli HLA. Prawdopodobieństwo urodzenia się dziecka z jednym z przedstawionych możliwych zestawów alleli HLA wynosi %.

b)Określ, w którym przypadku może być większa szansa przyjęcia się przeszczepu przez chorego – gdy dawcą narządu jest jedno z rodzeństwa, czy – gdy dawcą narządu jest rodzic. Odpowiedź uzasadnij.
c)Określ, czy geny HLA dziedziczą się zgodnie z II prawem Mendla. Uzasadnij odpowiedź.
d)Zaznacz poprawne dokończenie zdania.

W sposobie ekspresji genów HLA występuje

  1. kodominacja.
  2. dominacja zupełna.
  3. dominacja niezupełna.
e)Wyjaśnij, dlaczego w przypadku powtórnego przeszczepu narządu z podobnymi antygenami transplantacyjnymi jego odrzucenie następuje wcześniej niż za pierwszym razem.
f)Zaznacz poprawne dokończenie zdania.

Powtórne odrzucenie przeszczepu to głównie przejaw mechanizmu odporności

  1. nabytej.
  2. wrodzonej.
  3. nieswoistej humoralnej.
  4. nieswoistej komórkowej.

Zbiór zadań CKE, Poziom rozszerzony (Formuła 2015)Zadanie 74. (3 pkt)

Choroby człowieka Układ immunologiczny Zamknięte (np. testowe, prawda/fałsz) Podaj i uzasadnij/wyjaśnij

Droga szerzenia chorób zakaźnych, inaczej droga zakażenia – to sposób i mechanizm przenoszenia zarazków do organizmu ze środowiska zewnętrznego.
Możliwe jest przeniesienie zarazków przez kontakt seksualny, drogą pokarmową, oddechową, przez krew i przez wektory (stawonogi, gryzonie).
Jednym z najbardziej skutecznych sposobów profilaktyki chorób zakaźnych, obok przestrzegania zasad higieny osobistej i żywienia, są szczepienia.

Na podstawie: W. Irving, T. Boswell, D. Ala'Aldeen, Mikrobiologia medyczna. Krótkie wykłady, Warszawa 2012, s. 6.

a)Wśród wymienionych poniżej chorób bakteryjnych podkreśl wszystkie te, w przypadku których człowiek chory nie stanowi bezpośredniego źródła zakażenia.

Choroby: borelioza, czerwonka bakteryjna, dur brzuszny, cholera, gruźlica, tężec, wąglik.

b)Podaj, inny niż szczepienie, sposób zapobiegania zachorowaniu na cholerę.
c)Uzasadnij, że szczepionka zapewnia organizmowi odporność swoistą czynną. W odpowiedzi uwzględnij mechanizm jej działania.

Matura Czerwiec 2019, Poziom rozszerzony (Formuła 2007)Zadanie 25. (2 pkt)

Układ immunologiczny Choroby człowieka Zamknięte (np. testowe, prawda/fałsz) Podaj i uzasadnij/wyjaśnij

Do zakażenia człowieka wścieklizną dochodzi wskutek kontaktu ze śliną zakażonego zwierzęcia, np. podczas pogryzienia przez takie zwierzę. Pacjentom głęboko pokąsanym przez zwierzę chore (lub podejrzane o zakażenie wścieklizną) jak najszybciej podaje się surowicę odpornościową zawierającą immunoglobuliny skierowane przeciw antygenom wirusa wścieklizny, a następnie wykonuje się serię trzech szczepień zawierających inaktywowane cząstki wirusa.

Na podstawie: J.D. Ostrowska, T. Hermanowska-Szpakowicz, Wścieklizna i jej profilaktyka u ludzi, „Medycyna Wet”, 53 (3) 1991;
www.mp.pl/szczepienia

a)Uzasadnij, że opisany schemat postępowania z osobami potencjalnie zakażonymi wirusem wścieklizny można określić jako uodparnianie bierno-czynne. W odpowiedzi odnieś się do obu rodzajów odporności.
b)Oceń, czy poniższe stwierdzenia dotyczące reakcji odpornościowych uruchamianych w organizmie człowieka podczas stosowania uodparniania bierno-czynnego są prawdziwe. Zaznacz P, jeśli stwierdzenie jest prawdziwe, albo F – jeśli stwierdzenie jest fałszywe.
1. Podanie surowicy zawierającej immunoglobuliny przeciw wściekliźnie zapewnia choremu dłuższą odporność na tę chorobę niż podanie szczepionki. P F
2. W reakcji na podanie surowicy organizm pacjenta rozpoczyna samodzielne wytwarzanie przeciwciał przeciwko wirusowi wścieklizny. P F
3. Podanie drugiej i trzeciej dawki szczepionki przeciw wściekliźnie uruchamia w organizmie zaszczepionego wtórną odpowiedź immunologiczną. P F

Matura Czerwiec 2019, Poziom rozszerzony (Formuła 2015)Zadanie 15. (2 pkt)

Układ immunologiczny Choroby człowieka Zamknięte (np. testowe, prawda/fałsz) Podaj i uzasadnij/wyjaśnij

Do zakażenia człowieka wścieklizną dochodzi wskutek kontaktu ze śliną zakażonego zwierzęcia, np. podczas pogryzienia przez takie zwierzę. Pacjentom głęboko pokąsanym przez zwierzę chore (lub podejrzane o zakażenie wścieklizną) jak najszybciej podaje się surowicę odpornościową zawierającą immunoglobuliny skierowane przeciw antygenom wirusa wścieklizny, a następnie wykonuje się serię trzech szczepień zawierających inaktywowane cząstki wirusa.

Na podstawie: J.D. Ostrowska, T. Hermanowska-Szpakowicz, Wścieklizna i jej profilaktyka u ludzi, „Medycyna Wet”, 53 (3) 1991;
www.mp.pl/szczepienia

15.1. (0–1)

Uzasadnij, że opisany schemat postępowania z osobami potencjalnie zakażonymi wirusem wścieklizny można określić jako uodparnianie bierno-czynne. W odpowiedzi odnieś się do obu rodzajów odporności.

15.2. (0–1)

Oceń, czy poniższe stwierdzenia dotyczące reakcji odpornościowych uruchamianych w organizmie człowieka podczas stosowania uodparniania bierno-czynnego są prawdziwe. Zaznacz P, jeśli stwierdzenie jest prawdziwe, albo F – jeśli stwierdzenie jest fałszywe.

1. Podanie surowicy zawierającej immunoglobuliny przeciw wściekliźnie zapewnia choremu dłuższą odporność na tę chorobę niż podanie szczepionki. P F
2. W reakcji na podanie surowicy organizm pacjenta rozpoczyna samodzielne wytwarzanie przeciwciał przeciwko wirusowi wścieklizny. P F
3. Podanie drugiej i trzeciej dawki szczepionki przeciw wściekliźnie uruchamia w organizmie zaszczepionego wtórną odpowiedź immunologiczną. P F

Matura Maj 2019, Poziom podstawowy (Formuła 2007)Zadanie 15. (1 pkt)

Układ krążenia Układ immunologiczny Podaj i uzasadnij/wyjaśnij

W przypadku, gdy ciężarna matka mająca grupę krwi Rh– wytwarza przeciwciała skierowane przeciwko antygenom D własnego płodu mającego grupę krwi Rh+, może dojść do konfliktu serologicznego. Przeciwciała anty-Rh przenikają wówczas przez łożysko do krwiobiegu płodu i uszkadzają jego czerwone krwinki, co jest przyczyną choroby hemolitycznej.

Wyjaśnij, dlaczego choroba hemolityczna nie wystąpi w przypadku, gdy matka ma grupę krwi Rh+, a jej dziecko ma grupę krwi Rh–.

Matura Maj 2019, Poziom podstawowy (Formuła 2007)Zadanie 14. (1 pkt)

Układ immunologiczny Uzupełnij/narysuj wykres, schemat lub tabelę

Układ odpornościowy zapewnia organizmowi obronę przed różnymi czynnikami, np. substancjami toksycznymi, wirusami, bakteriami, komórkami nowotworowymi. Zwalczanie takich czynników, po ich rozpoznaniu, odbywa się w różny sposób.

Określ rodzaj odporności wyrażanej przez organizm człowieka w wyniku reakcji przedstawionych w tabeli. Wpisz znak „+” w odpowiednie pola tabeli.

Reakcja organizmu Odporność nieswoista Odporność swoista
kichanie, kaszel
wytwarzanie przeciwciał
niewybiórcze pożeranie komórek przez makrofagi

Matura Maj 2019, Poziom rozszerzony (Formuła 2007)Zadanie 21. (1 pkt)

Układ immunologiczny Zamknięte (np. testowe, prawda/fałsz)

Uzupełnij poniższe zdania dotyczące limfocytów tak, aby zawierały one informacje prawdziwe. Podkreśl w każdym nawiasie właściwe określenie.

Limfocyty B i T biorą udział w mechanizmach odporności (swoistej / nieswoistej). W grasicy człowieka dojrzewają i nabywają kompetencji (limfocyty B / limfocyty T). Za wytwarzanie i uwalnianie przeciwciał odpowiadają (limfocyty B / limfocyty T) i jest to odporność (humoralna / komórkowa).

Matura Maj 2019, Poziom rozszerzony (Formuła 2015)Zadanie 14. (3 pkt)

Skład organizmów Układ immunologiczny Zamknięte (np. testowe, prawda/fałsz) Podaj i uzasadnij/wyjaśnij

Na schemacie przedstawiono budowę cząsteczki przeciwciała – immunoglobuliny klasy IgG. Ta cząsteczka składa się z połączonych mostkami disiarczkowymi czterech łańcuchów polipeptydowych:

  • dwóch takich samych łańcuchów ciężkich
  • dwóch takich samych łańcuchów lekkich.

Część fragmentu Fab oznaczona na schemacie literą V charakteryzuje się wysoką zmiennością struktury – każdy rodzaj przeciwciała ma w tym obszarze inną strukturę przestrzenną, natomiast fragment Fc jest stały, czyli taki sam dla wszystkich przeciwciał w danej klasie.

Na podstawie: J. Gołąb, M. Jakóbisiak, W. Lasek, Immunologia, Warszawa 2002.

14.1. (0–1)

Na podstawie przedstawionych informacji i własnej wiedzy określ rolę fragmentu Fab i rolę fragmentu Fc tego przeciwciała. Wybierz odpowiedź spośród 1.–3. i wpisz w wyznaczone miejsce.

Fragment Fab ...............
Fragment Fc .................
1. wiąże się specyficznie z określonymi antygenami.
2. łączy się z łańcuchami lekkimi innych przeciwciał.
3. przyłącza się do receptorów w błonie komórkowej komórek efektorowych układu odpornościowego.

14.2. (0–1)

Podaj liczbę mostków disiarczkowych, które stabilizują 4-rzędową strukturę przedstawionej immunoglobuliny.

14.3. (0–1)

Zaznacz poprawne dokończenie zdania – wybierz odpowiedź spośród A–B oraz odpowiedź spośród 1.–4.

Przeciwciała są zawarte w

A. szczepionce, której podanie
wywołuje odporność
1. czynną naturalną.
2. czynną sztuczną.
B. surowicy odpornościowej, 3. bierną naturalną.
4. bierną sztuczną.

Matura Maj 2019, Poziom rozszerzony (Formuła 2015)Zadanie 9. (4 pkt)

Protisty Układ immunologiczny Zamknięte (np. testowe, prawda/fałsz) Podaj i uzasadnij/wyjaśnij

Świdrowiec gambijski (Trypanosoma gambiense) to protist wywołujący śpiączkę afrykańską. Pasożytuje on we krwi różnych ssaków (np. bydła), z których może być przeniesiony na człowieka. U ssaków świdrowiec rozmnaża się przez podział komórki. Jest roznoszony przez krwiopijną, trudną do zwalczenia, muchę tse-tse, w której organizmie przechodzi część swojego cyklu życiowego. Dopiero w 2014 roku odkryto, że w cyklu świdrowca na tym etapie może zachodzić mejoza, a następnie – zapłodnienie. Rozmnażanie płciowe nie jest jednak niezbędne do zamknięcia cyklu życiowego tego pasożyta.
Powierzchnia komórki świdrowca jest pokryta milionami kopii jednego rodzaju białka – wysokozmiennej glikoproteiny powierzchniowej (VSG). Po wniknięciu do krwi gospodarza każde kolejne pokolenie pasożyta wytwarza inny wariant antygenu VSG o odmiennej budowie molekularnej. Do zmiany wariantu białka powierzchniowego dochodzi przez przeniesienie i rearanżację (zamianę) fragmentów genomu, w którym znajdują się sekwencje kodujące VSG. Na wykresie przedstawiono zmiany liczebności pasożyta we krwi oraz zmiany białka powierzchniowego (VSG1, VSG2, VSG3) w kolejnych pokoleniach świdrowca we krwi człowieka.

Na podstawie: N.A. Campbell i inni, Biologia, Poznań 2012;
C. Conway i inni, Two pathways of homologus recombination in Trypanosoma brucei, „Molecular Microbiology”, 45(6), 2002.

9.1. (0–1)

Oceń, czy poniższe informacje dotyczące świdrowca gambijskiego są prawdziwe. Zaznacz P, jeśli informacja jest prawdziwa, albo F – jeśli jest fałszywa.

1. Epidemie śpiączki afrykańskiej mogą występować wyłącznie na terenach, gdzie żyje mucha tse-tse. P F
2. Świdrowcem gambijskim można się zarazić przez kontakt z chorą osobą. P F
3. Podczas rozwoju świdrowca gambijskiego we krwi człowieka DNA świdrowca ulega rekombinacji. P F

9.2. (0–1)

Określ, który organizm – człowiek czy mucha tse-tse – może być uważany za żywiciela ostatecznego świdrowca gambijskiego. Odpowiedź uzasadnij.

Żywicielem ostatecznym jest , ponieważ

9.3. (0–1)

Określ ploidalność (n / 2n) formy świdrowca występującej w organizmach ssaków. Odpowiedź uzasadnij.

W organizmie ssaków występuje forma świdrowca, ponieważ

9.4. (0–1)

Na podstawie przedstawionych informacji wyjaśnij, dlaczego tak trudne jest zwalczenie świdrowca przez układ odpornościowy organizmu człowieka.

Matura Czerwiec 2018, Poziom rozszerzony (Formuła 2007)Zadanie 12. (3 pkt)

Grzyby Budowa i funkcje komórki Układ immunologiczny Zamknięte (np. testowe, prawda/fałsz) Podaj/wymień

Stosowane powszechnie w przemyśle piekarniczym i piwowarskim drożdże szlachetne (Saccharomyces cerevisiae) są wykorzystywane również w przemyśle farmaceutycznym i biotechnologii. Są stosowane np. do produkcji szczepionki rekombinowanej przeciw wirusowemu zapaleniu wątroby typu B (WZW B), która zazwyczaj jest trzykrotnie podawana osobie szczepionej.
Poniżej na rysunku A przedstawiono budowę komórki drożdży, a na rysunku B – rozmnażanie się drożdży.

a)Na podstawie rysunku A uzupełnij poniższe zdania – podkreśl w nawiasach właściwe określenia, oraz w wyznaczonych miejscach wpisz nazwy odpowiednich organellów komórkowych.

Przedstawiona na rysunku A komórka jest (prokariotyczna / eukariotyczna), ponieważ ma .
Cechami odróżniającymi jej budowę od budowy typowej komórki zwierzęcej jest obecność i .
Obecność glikogenu jako materiału zapasowego jest cechą odróżniającą tę komórkę od komórki (roślinnej / zwierzęcej).

b)Oceń, czy poniższe informacje dotyczące drożdży są prawdziwe. Zaznacz P, jeśli informacja jest prawdziwa, albo F – jeśli jest fałszywa.
1. Są wielokomórkowymi grzybami, które rozmnażają się przez pączkowanie. P F
2. Wytwarzają owocniki zbudowane z nibytkanki (plektenchymy). P F
3. W warunkach beztlenowych drożdże przeprowadzają fermentację alkoholową. P F
c)Spośród podanych poniżej wybierz i podkreśl trzy rodzaje odporności uzyskiwanej dzięki szczepieniu przeciwko WZW.

swoista     nieswoista    czynna     bierna     naturalna     sztuczna

Matura Czerwiec 2018, Poziom rozszerzony (Formuła 2015)Zadanie 6. (4 pkt)

Grzyby Budowa i funkcje komórki Układ immunologiczny Zamknięte (np. testowe, prawda/fałsz) Podaj i uzasadnij/wyjaśnij

Stosowane powszechnie w przemyśle piekarniczym i piwowarskim drożdże szlachetne (Saccharomyces cerevisiae) są wykorzystywane również w przemyśle farmaceutycznym i biotechnologii. Są stosowane np. do produkcji szczepionki rekombinowanej przeciw wirusowemu zapaleniu wątroby typu B (WZW B), która zazwyczaj jest trzykrotnie podawana osobie szczepionej.
Poniżej na rysunku A przedstawiono budowę komórki drożdży, a na rysunku B – rozmnażanie się drożdży.

6.1. (0–1)

Na podstawie rysunku A uzupełnij poniższe zdania – podkreśl w nawiasach właściwe określenia, oraz w wyznaczonych miejscach wpisz nazwy odpowiednich organellów komórkowych.

Przedstawiona na rysunku A komórka jest (prokariotyczna / eukariotyczna), ponieważ ma .
Cechami odróżniającymi jej budowę od budowy typowej komórki zwierzęcej jest obecność i .
Obecność glikogenu jako materiału zapasowego jest cechą odróżniającą tę komórkę od komórki (roślinnej / zwierzęcej).

6.2. (0–1)

Oceń, czy poniższe informacje dotyczące drożdży są prawdziwe. Zaznacz P, jeśli informacja jest prawdziwa, albo F – jeśli jest fałszywa.

1. Są wielokomórkowymi grzybami, które rozmnażają się przez pączkowanie. P F
2. Wytwarzają owocniki zbudowane z nibytkanki (plektenchymy). P F
3. W warunkach beztlenowych drożdże przeprowadzają fermentację alkoholową. P F

6.3. (0–1)

Spośród podanych poniżej wybierz i podkreśl trzy rodzaje odporności uzyskiwanej dzięki szczepieniu przeciwko WZW.

swoista     nieswoista    czynna     bierna     naturalna     sztuczna

6.4. (0–1)

Wyjaśnij, dlaczego szczepionkę przeciwko WZW typu B powtarza się trzykrotnie.

Matura Maj 2018, Poziom podstawowy (Formuła 2007)Zadanie 17. (2 pkt)

Układ immunologiczny Podaj i uzasadnij/wyjaśnij Podaj/wymień

Na poniższych rysunkach (A i B) zilustrowano dwa sposoby uzyskiwania odporności na określone patogeny.

a)Spośród poniższych określeń wybierz po dwa, które poprawnie opiszą nabytą odporność na określone patogeny w przypadku przedstawionym na rysunku A i w przypadku przedstawionym na rysunku B.

Uwaga: To samo określenie może zostać wybrane dwukrotnie.

bierna     naturalna     swoista     sztuczna     nieswoista

A.:     B.:

b)Wyjaśnij, na czym polega różnica w nabywaniu odporności w przypadku przedstawionym na rysunku A i w przypadku przedstawionym na rysunku B.

Matura Maj 2018, Poziom podstawowy (Formuła 2007)Zadanie 16. (1 pkt)

Układ immunologiczny Podaj i uzasadnij/wyjaśnij

Przyczyną wielu schorzeń człowieka jest stres. Pod wpływem kortyzolu, który w chronicznym stresie jest produkowany niemal bez przerwy, zmniejsza się liczba białych ciałek krwi oraz zdolność organizmu do wytwarzania przeciwciał.

Wykaż związek między opisanym w tekście działaniem kortyzolu w chronicznym stresie a zwiększoną zapadalnością ludzi, znajdujących się pod jego wpływem, na różnego rodzaju infekcje.

Matura Maj 2018, Poziom rozszerzony (Formuła 2007)Zadanie 22. (3 pkt)

Enzymy Układ immunologiczny Zamknięte (np. testowe, prawda/fałsz) Podaj i uzasadnij/wyjaśnij

Kwas foliowy (witamina z grupy B) jest niezbędny przy podziale komórkowym i dlatego odgrywa szczególną rolę w tkankach, w których podziały komórkowe są intensywne. Pełni on funkcję koenzymu w reakcjach przenoszenia grup jednowęglowych w procesie syntezy zasad purynowych i pirymidynowych. Podczas tych reakcji kwas foliowy ulega utlenieniu, a regenerowanie polega na ponownej jego redukcji. Antagonistą kwasu foliowego jest metotreksat (MTX). Wiąże się on z centrum aktywnym enzymu odpowiedzialnego za reakcję redukcji kwasu foliowego 10 000 razy silniej niż naturalny substrat. Metotreksat działa swoiście na dzielące się komórki, głównie w fazie S cyklu komórkowego, i dlatego jest stosowany w leczeniu wielu chorób nowotworowych. Ubocznym skutkiem opisanej chemioterapii okazuje się wpływ leku na inne prawidłowo dzielące się komórki organizmu, np. na niewyspecjalizowane komórki szpiku kostnego.

Na podstawie: J. Berg, J. Tymoczko, L. Stryer, Biochemia, Warszawa 2009.

a)Zaznacz właściwe dokończenie zdania wybrane spośród A–B oraz jego poprawne uzasadnienie wybrane spośród 1.–3.

Po podaniu MTX zachodzi inhibicja

A. kompetycyjna, ponieważ 1. metotreksat, podobnie jak kwas foliowy, pełni funkcję koenzymu w reakcjach redukcji grup jednowęglowych.
2. metotreksat wiąże się z centrum aktywnym enzymu odpowiedzialnego za reakcję redukcji kwasu foliowego.
B. niekompetycyjna, 3. metotreksat zmienia kształt centrum aktywnego enzymu katalizującego redukcję kwasu foliowego, co jest przyczyną wypierania cząsteczek tego kwasu.
b)Określ, czy podczas leczenia pacjenta chemioterapią, z wykorzystaniem dużych dawek MTX, można odwrócić inhibicję reakcji redukcji kwasu foliowego za pomocą wysokiej dawki tego kwasu. Odpowiedź uzasadnij, odwołując się do właściwości metotreksatu.
c)Podaj, dlaczego jednym ze skutków ubocznych stosowania małych dawek metotreksatu jest zahamowanie wytwarzania przeciwciał w organizmie. W odpowiedzi odnieś się do komórek układu odpornościowego.

Strony